EMAIL THIS PAGE TO A FRIEND

ANKRD20A5P

ankyrin repeat domain 20 family, member A5, pseudogene

14 Gene Product Result for
Synonyms: ANKRD20A5
Species: Human ANKRD20A5P(440482)
UniProtKB ID: A0PJZ0, Q4G1B6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029999 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062386 predicted 953
2 SASI_Hs01_00062387 predicted 864
3 SASI_Hs01_00062390 predicted 1274
4 SASI_Hs01_00062391 predicted 1281
5 SASI_Hs01_00062392 predicted 1217
6 SASI_Hs01_00062393 predicted 1141
7 SASI_Hs01_00062394 predicted 1139
8 SASI_Hs01_00062395 predicted 1271
9 SASI_Hs02_00307614 predicted 1200
10 SASI_Hs01_00062388 predicted 787
11 SASI_Hs01_00062389 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029999
ANKRD20A5P MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A5, pseudogene
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-720s1c1
Sequence:CCGGGTATAGTGAGAGCACCTCACTCTCGAGAGTGAGGTGCTCTCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029999.1-880s1c1
Sequence:CCGGCCCTGAATGCAAATGCAAATACTCGAGTATTTGCATTTGCATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-667s1c1
Sequence:CCGGGCCAATCCAAACCTTAAGGATCTCGAGATCCTTAAGGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-604s1c1
Sequence:CCGGCCTTTGATACAGGCTGTCCATCTCGAGATGGACAGCCTGTATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-661s1c1
Sequence:CCGGCATGGTGCCAATCCAAACCTTCTCGAGAAGGTTTGGATTGGCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-631s1c1
Sequence:CCGGGAAGAGGCTTGTGCCGTTATTCTCGAGAATAACGGCACAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-500s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029999
ANKRD20A5P MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A5, pseudogene
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-720s1c1
Sequence:CCGGGTATAGTGAGAGCACCTCACTCTCGAGAGTGAGGTGCTCTCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029999.1-880s1c1
Sequence:CCGGCCCTGAATGCAAATGCAAATACTCGAGTATTTGCATTTGCATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-667s1c1
Sequence:CCGGGCCAATCCAAACCTTAAGGATCTCGAGATCCTTAAGGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-604s1c1
Sequence:CCGGCCTTTGATACAGGCTGTCCATCTCGAGATGGACAGCCTGTATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-661s1c1
Sequence:CCGGCATGGTGCCAATCCAAACCTTCTCGAGAAGGTTTGGATTGGCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-631s1c1
Sequence:CCGGGAAGAGGCTTGTGCCGTTATTCTCGAGAATAACGGCACAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-500s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029999
ANKRD20A5P MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A5, pseudogene
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-720s1c1
Sequence:CCGGGTATAGTGAGAGCACCTCACTCTCGAGAGTGAGGTGCTCTCACTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029999.1-880s1c1
Sequence:CCGGCCCTGAATGCAAATGCAAATACTCGAGTATTTGCATTTGCATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-667s1c1
Sequence:CCGGGCCAATCCAAACCTTAAGGATCTCGAGATCCTTAAGGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029999.1-604s1c1
Sequence:CCGGCCTTTGATACAGGCTGTCCATCTCGAGATGGACAGCCTGTATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-661s1c1
Sequence:CCGGCATGGTGCCAATCCAAACCTTCTCGAGAAGGTTTGGATTGGCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-631s1c1
Sequence:CCGGGAAGAGGCTTGTGCCGTTATTCTCGAGAATAACGGCACAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029999.1-500s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks