EMAIL THIS PAGE TO A FRIEND

ANKRD22

ankyrin repeat domain 22

56 Gene Product Result for
UniProtKB ID: Q5VYY1, B2R9Y7, Q8WU06
Gene ID:
Mouse(52024) ankyrin repeat domain 22
Rat(294093) ankyrin repeat domain 22
Zebrafish(393244) ankyrin repeat domain 22
chicken(771419) ankyrin repeat domain 22
cow(504991) ankyrin repeat domain 22
domestic cat(101093047) ankyrin repeat domain 22
dog(486468) ankyrin repeat domain 22
domestic guinea pig(100725588) ankyrin repeat domain 22
naked mole-rat(101704403) ankyrin repeat domain 22
sheep(101120533) ankyrin repeat domain 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144590 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039381 MISSION® esiRNA esiRNA human ANKRD22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144590 Rosetta Predictions human pricing
XM_001079895 Rosetta Predictions rat pricing
XM_220065 Rosetta Predictions rat pricing
NM_024204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190776 predicted 458
2 SASI_Hs01_00190777 predicted 418
3 SASI_Hs01_00190778 predicted 882
4 SASI_Hs02_00364381 predicted 776
5 SASI_Hs01_00190779 predicted 458
6 SASI_Hs02_00364382 predicted 701
7 SASI_Hs01_00190782 predicted 918
8 SASI_Hs01_00190785 predicted 877
9 SASI_Hs02_00364383 predicted 776
10 SASI_Hs02_00364384 predicted 903
11 SASI_Hs01_00190780 predicted 714
12 SASI_Hs01_00190781 predicted 693
13 SASI_Hs01_00190783 predicted 476
14 SASI_Hs01_00190784 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365894 predicted 378
2 SASI_Rn02_00365895 predicted 281
3 SASI_Rn02_00365896 predicted 503
4 SASI_Rn02_00365897 predicted 550
5 SASI_Rn02_00365898 predicted 277
6 SASI_Rn02_00365899 predicted 492
7 SASI_Rn02_00365900 predicted 252
8 SASI_Rn02_00365901 predicted 212
9 SASI_Rn02_00365902 predicted 307
10 SASI_Rn02_00365903 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378995 predicted 382
2 SASI_Rn02_00378996 predicted 285
3 SASI_Rn02_00378997 predicted 502
4 SASI_Rn02_00378998 predicted 543
5 SASI_Rn02_00378999 predicted 285
6 SASI_Rn02_00379000 predicted 495
7 SASI_Rn02_00379001 predicted 258
8 SASI_Rn02_00379002 predicted 204
9 SASI_Rn02_00379003 predicted 302
10 SASI_Rn02_00379004 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327559 predicted 801
2 SASI_Mm02_00327560 predicted 752
3 SASI_Mm01_00106603 predicted 779
4 SASI_Mm01_00106604 predicted 682
5 SASI_Mm01_00106605 predicted 321
6 SASI_Mm01_00106606 predicted 514
7 SASI_Mm01_00106607 predicted 447
8 SASI_Mm01_00106608 predicted 474
9 SASI_Mm01_00106609 predicted 519
10 SASI_Mm01_00106610 predicted 367
11 SASI_Mm01_00106602 predicted 351
12 SASI_Mm01_00106611 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024204
ANKRD22 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-443s1c1
Sequence:CCGGCCTCATGGTATCAAAGACAAACTCGAGTTTGTCTTTGATACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-284s1c1
Sequence:CCGGCCTGAGAATTGTCTCCTTCCTCTCGAGAGGAAGGAGACAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-216s1c1
Sequence:CCGGCATTATGTGGATGTTCAAGATCTCGAGATCTTGAACATCCACATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-499s1c1
Sequence:CCGGCTGGCGTAGAAGTTAATGCTACTCGAGTAGCATTAACTTCTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-420s1c1
Sequence:CCGGCCTGTCTTGCTAATTGGATATCTCGAGATATCCAATTAGCAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024204
ANKRD22 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-443s1c1
Sequence:CCGGCCTCATGGTATCAAAGACAAACTCGAGTTTGTCTTTGATACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-284s1c1
Sequence:CCGGCCTGAGAATTGTCTCCTTCCTCTCGAGAGGAAGGAGACAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-216s1c1
Sequence:CCGGCATTATGTGGATGTTCAAGATCTCGAGATCTTGAACATCCACATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-499s1c1
Sequence:CCGGCTGGCGTAGAAGTTAATGCTACTCGAGTAGCATTAACTTCTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-420s1c1
Sequence:CCGGCCTGTCTTGCTAATTGGATATCTCGAGATATCCAATTAGCAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024204
ANKRD22 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-443s1c1
Sequence:CCGGCCTCATGGTATCAAAGACAAACTCGAGTTTGTCTTTGATACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-284s1c1
Sequence:CCGGCCTGAGAATTGTCTCCTTCCTCTCGAGAGGAAGGAGACAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-216s1c1
Sequence:CCGGCATTATGTGGATGTTCAAGATCTCGAGATCTTGAACATCCACATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-499s1c1
Sequence:CCGGCTGGCGTAGAAGTTAATGCTACTCGAGTAGCATTAACTTCTACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024204.3-420s1c1
Sequence:CCGGCCTGTCTTGCTAATTGGATATCTCGAGATATCCAATTAGCAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144590
ANKRD22 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-365s1c1
Sequence:CCGGCCAGAAAGAGAGAACCTGCTTCTCGAGAAGCAGGTTCTCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-446s1c1
Sequence:CCGGGCCTGTTCTGCTTATTGGGTACTCGAGTACCCAATAAGCAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-308s1c1
Sequence:CCGGGCATGTGAGAATCGTTTCCTTCTCGAGAAGGAAACGATTCTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144590.1-967s1c1
Sequence:CCGGCTTCAGTCAGAAACTGATGTTCTCGAGAACATCAGTTTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-504s1c1
Sequence:CCGGCTTGTACGAATGCTACTTGATCTCGAGATCAAGTAGCATTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144590.1-917s1c1
Sequence:CCGGCCATGGCCGTAATCCTTCTAACTCGAGTTAGAAGGATTACGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-884s21c1
Sequence:CCGGGGATATTGCACGGAGATTAAACTCGAGTTTAATCTCCGTGCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-925s21c1
Sequence:CCGGTGCTAAGGAAAGCATTGTAATCTCGAGATTACAATGCTTTCCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144590.2-985s21c1
Sequence:CCGGGACTGGATTCTATCTTCATTTCTCGAGAAATGAAGATAGAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144590
ANKRD22 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-365s1c1
Sequence:CCGGCCAGAAAGAGAGAACCTGCTTCTCGAGAAGCAGGTTCTCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-446s1c1
Sequence:CCGGGCCTGTTCTGCTTATTGGGTACTCGAGTACCCAATAAGCAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-308s1c1
Sequence:CCGGGCATGTGAGAATCGTTTCCTTCTCGAGAAGGAAACGATTCTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144590.1-967s1c1
Sequence:CCGGCTTCAGTCAGAAACTGATGTTCTCGAGAACATCAGTTTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-504s1c1
Sequence:CCGGCTTGTACGAATGCTACTTGATCTCGAGATCAAGTAGCATTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144590.1-917s1c1
Sequence:CCGGCCATGGCCGTAATCCTTCTAACTCGAGTTAGAAGGATTACGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-884s21c1
Sequence:CCGGGGATATTGCACGGAGATTAAACTCGAGTTTAATCTCCGTGCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-925s21c1
Sequence:CCGGTGCTAAGGAAAGCATTGTAATCTCGAGATTACAATGCTTTCCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144590.2-985s21c1
Sequence:CCGGGACTGGATTCTATCTTCATTTCTCGAGAAATGAAGATAGAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144590
ANKRD22 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-365s1c1
Sequence:CCGGCCAGAAAGAGAGAACCTGCTTCTCGAGAAGCAGGTTCTCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-446s1c1
Sequence:CCGGGCCTGTTCTGCTTATTGGGTACTCGAGTACCCAATAAGCAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-308s1c1
Sequence:CCGGGCATGTGAGAATCGTTTCCTTCTCGAGAAGGAAACGATTCTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144590.1-967s1c1
Sequence:CCGGCTTCAGTCAGAAACTGATGTTCTCGAGAACATCAGTTTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144590.1-504s1c1
Sequence:CCGGCTTGTACGAATGCTACTTGATCTCGAGATCAAGTAGCATTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144590.1-917s1c1
Sequence:CCGGCCATGGCCGTAATCCTTCTAACTCGAGTTAGAAGGATTACGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-884s21c1
Sequence:CCGGGGATATTGCACGGAGATTAAACTCGAGTTTAATCTCCGTGCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144590.2-925s21c1
Sequence:CCGGTGCTAAGGAAAGCATTGTAATCTCGAGATTACAATGCTTTCCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144590.2-985s21c1
Sequence:CCGGGACTGGATTCTATCTTCATTTCTCGAGAAATGAAGATAGAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks