EMAIL THIS PAGE TO A FRIEND

ANKRD23

ankyrin repeat domain 23

67 Gene Product Result for
Synonyms: DARP MARP3
UniProtKB ID: Q86SG2, Q711K7, Q8NAJ7
Gene ID:
Human(200539) Summary: This gene is a member of the muscle ankyrin repeat protein (MARP) family and encodes a protein with four tandem ankyrin-like repeats. The protein is localized to the nucleus, functioning as a transcriptional regulator. Expression of this protein is induced during recovery following starvation. [provided by RefSeq, Jul 2008]
Mouse(78321) ankyrin repeat domain 23
Rat(316330) ankyrin repeat domain 23
sheep(101113927) ankyrin repeat domain 23
naked mole-rat(101711503) ankyrin repeat domain 23
domestic guinea pig(100718218) ankyrin repeat domain 23
dog(481344) ankyrin repeat domain 23
domestic cat(101097554) ankyrin repeat domain 23
cow(100296784) ankyrin repeat domain 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144994 Rosetta Predictions human pricing
NM_001108211 Rosetta Predictions rat pricing
NM_153502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194693 predicted 398
2 SASI_Hs01_00194694 predicted 726
3 SASI_Hs02_00364826 predicted 489
4 SASI_Hs01_00194695 predicted 534
5 SASI_Hs01_00194697 predicted 789
6 SASI_Hs01_00194698 predicted 591
7 SASI_Hs01_00194700 predicted 628
8 SASI_Hs01_00194701 predicted 1250
9 SASI_Hs01_00194702 predicted 732
10 SASI_Hs02_00364827 predicted 1300
11 SASI_Hs01_00194696 predicted 595
12 SASI_Hs01_00194699 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236414 predicted 1688
2 SASI_Rn02_00236415 predicted 1410
3 SASI_Rn02_00236416 predicted 980
4 SASI_Rn02_00236417 predicted 1060
5 SASI_Rn02_00236418 predicted 1337
6 SASI_Rn02_00236419 predicted 454
7 SASI_Rn02_00236420 predicted 975
8 SASI_Rn02_00236421 predicted 883
9 SASI_Rn02_00236422 predicted 789
10 SASI_Rn02_00236423 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146882 predicted 852
2 SASI_Mm02_00343242 predicted 723
3 SASI_Mm01_00146883 predicted 1355
4 SASI_Mm01_00146885 predicted 215
5 SASI_Mm01_00146886 predicted 775
6 SASI_Mm01_00146887 predicted 583
7 SASI_Mm01_00146888 predicted 713
8 SASI_Mm01_00146889 predicted 793
9 SASI_Mm01_00146890 predicted 1400
10 SASI_Mm01_00146891 predicted 1390
11 SASI_Mm01_00146884 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153502
ANKRD23 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1419s21c1
Sequence:CCGGGTTCTAGCCATCTCGTCTTCACTCGAGTGAAGACGAGATGGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-800s21c1
Sequence:CCGGCGAAACTGCTGCTGCTCTATGCTCGAGCATAGAGCAGCAGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1240s21c1
Sequence:CCGGACGGACTGGTCTTGGCCTATTCTCGAGAATAGGCCAAGACCAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-597s21c1
Sequence:CCGGCATTCTCAAACGGCTGCTTAACTCGAGTTAAGCAGCCGTTTGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-632s21c1
Sequence:CCGGTCAACGCACAAGACAAGATCTCTCGAGAGATCTTGTCTTGTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153502.2-991s1c1
Sequence:CCGGCCAGTCCTAAATAGTTCTTTACTCGAGTAAAGAACTATTTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-252s1c1
Sequence:CCGGCTTGGTTCAAAGACGAAGAAACTCGAGTTTCTTCGTCTTTGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-726s1c1
Sequence:CCGGCCACATCAACGCACAGGATAACTCGAGTTATCCTGTGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-526s1c1
Sequence:CCGGGCTGCTATAGAAGTACGGGATCTCGAGATCCCGTACTTCTATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-67s1c1
Sequence:CCGGGATAGGAAAGCGTTGGAGTTTCTCGAGAAACTCCAACGCTTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153502
ANKRD23 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1419s21c1
Sequence:CCGGGTTCTAGCCATCTCGTCTTCACTCGAGTGAAGACGAGATGGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-800s21c1
Sequence:CCGGCGAAACTGCTGCTGCTCTATGCTCGAGCATAGAGCAGCAGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1240s21c1
Sequence:CCGGACGGACTGGTCTTGGCCTATTCTCGAGAATAGGCCAAGACCAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-597s21c1
Sequence:CCGGCATTCTCAAACGGCTGCTTAACTCGAGTTAAGCAGCCGTTTGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-632s21c1
Sequence:CCGGTCAACGCACAAGACAAGATCTCTCGAGAGATCTTGTCTTGTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153502.2-991s1c1
Sequence:CCGGCCAGTCCTAAATAGTTCTTTACTCGAGTAAAGAACTATTTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-252s1c1
Sequence:CCGGCTTGGTTCAAAGACGAAGAAACTCGAGTTTCTTCGTCTTTGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-726s1c1
Sequence:CCGGCCACATCAACGCACAGGATAACTCGAGTTATCCTGTGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-526s1c1
Sequence:CCGGGCTGCTATAGAAGTACGGGATCTCGAGATCCCGTACTTCTATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-67s1c1
Sequence:CCGGGATAGGAAAGCGTTGGAGTTTCTCGAGAAACTCCAACGCTTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153502
ANKRD23 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1419s21c1
Sequence:CCGGGTTCTAGCCATCTCGTCTTCACTCGAGTGAAGACGAGATGGCTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-800s21c1
Sequence:CCGGCGAAACTGCTGCTGCTCTATGCTCGAGCATAGAGCAGCAGCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153502.3-1240s21c1
Sequence:CCGGACGGACTGGTCTTGGCCTATTCTCGAGAATAGGCCAAGACCAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-597s21c1
Sequence:CCGGCATTCTCAAACGGCTGCTTAACTCGAGTTAAGCAGCCGTTTGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153502.3-632s21c1
Sequence:CCGGTCAACGCACAAGACAAGATCTCTCGAGAGATCTTGTCTTGTGCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153502.2-991s1c1
Sequence:CCGGCCAGTCCTAAATAGTTCTTTACTCGAGTAAAGAACTATTTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-252s1c1
Sequence:CCGGCTTGGTTCAAAGACGAAGAAACTCGAGTTTCTTCGTCTTTGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-726s1c1
Sequence:CCGGCCACATCAACGCACAGGATAACTCGAGTTATCCTGTGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-526s1c1
Sequence:CCGGGCTGCTATAGAAGTACGGGATCTCGAGATCCCGTACTTCTATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153502.2-67s1c1
Sequence:CCGGGATAGGAAAGCGTTGGAGTTTCTCGAGAAACTCCAACGCTTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144994
ANKRD23 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 23
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-75s21c1
Sequence:CCGGGAAGGGAAAGTGTTGGGATTTCTCGAGAAATCCCAACACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-211s21c1
Sequence:CCGGGATTTAACAGTACCAGATTTACTCGAGTAAATCTGGTACTGTTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144994.7-2240s21c1
Sequence:CCGGCATGGGTCCTGGGTTACATTACTCGAGTAATGTAACCCAGGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-731s21c1
Sequence:CCGGCCACCTGAACGCACAGGATAACTCGAGTTATCCTGTGCGTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-592s21c1
Sequence:CCGGGACATCTGGTCATCCTCAAACCTCGAGGTTTGAGGATGACCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144994.6-1543s1c1
Sequence:CCGGGCTCTAGACAACTTTGGTCATCTCGAGATGACCAAAGTTGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-405s1c1
Sequence:CCGGCTGATTGACAAGTACTTGACACTCGAGTGTCAAGTACTTGTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-173s1c1
Sequence:CCGGGCTGAAATTGGAAGAAGAGAACTCGAGTTCTCTTCTTCCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144994
ANKRD23 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 23
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-75s21c1
Sequence:CCGGGAAGGGAAAGTGTTGGGATTTCTCGAGAAATCCCAACACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-211s21c1
Sequence:CCGGGATTTAACAGTACCAGATTTACTCGAGTAAATCTGGTACTGTTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144994.7-2240s21c1
Sequence:CCGGCATGGGTCCTGGGTTACATTACTCGAGTAATGTAACCCAGGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-731s21c1
Sequence:CCGGCCACCTGAACGCACAGGATAACTCGAGTTATCCTGTGCGTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-592s21c1
Sequence:CCGGGACATCTGGTCATCCTCAAACCTCGAGGTTTGAGGATGACCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144994.6-1543s1c1
Sequence:CCGGGCTCTAGACAACTTTGGTCATCTCGAGATGACCAAAGTTGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-405s1c1
Sequence:CCGGCTGATTGACAAGTACTTGACACTCGAGTGTCAAGTACTTGTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-173s1c1
Sequence:CCGGGCTGAAATTGGAAGAAGAGAACTCGAGTTCTCTTCTTCCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144994
ANKRD23 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 23
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-75s21c1
Sequence:CCGGGAAGGGAAAGTGTTGGGATTTCTCGAGAAATCCCAACACTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-211s21c1
Sequence:CCGGGATTTAACAGTACCAGATTTACTCGAGTAAATCTGGTACTGTTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144994.7-2240s21c1
Sequence:CCGGCATGGGTCCTGGGTTACATTACTCGAGTAATGTAACCCAGGACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-731s21c1
Sequence:CCGGCCACCTGAACGCACAGGATAACTCGAGTTATCCTGTGCGTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144994.7-592s21c1
Sequence:CCGGGACATCTGGTCATCCTCAAACCTCGAGGTTTGAGGATGACCAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144994.6-1543s1c1
Sequence:CCGGGCTCTAGACAACTTTGGTCATCTCGAGATGACCAAAGTTGTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-405s1c1
Sequence:CCGGCTGATTGACAAGTACTTGACACTCGAGTGTCAAGTACTTGTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144994.6-173s1c1
Sequence:CCGGGCTGAAATTGGAAGAAGAGAACTCGAGTTCTCTTCTTCCAATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks