EMAIL THIS PAGE TO A FRIEND

ANKRD24

ankyrin repeat domain 24

53 Gene Product Result for
UniProtKB ID: Q8TF21, O75268, O95781
Gene ID:
Mouse(70615) ankyrin repeat domain 24
Rat(299639) ankyrin repeat domain 24
Zebrafish(565326) ankyrin repeat domain 24
domestic cat(101100787) ankyrin repeat domain 24
cow(530559) ankyrin repeat domain 24
Horse(100146929) ankyrin repeat domain 24
dog(485044) ankyrin repeat domain 24
chicken(428331) ankyrin repeat domain 24
domestic guinea pig(100734388) ankyrin repeat domain 24
naked mole-rat(101705758) ankyrin repeat domain 24
sheep(101115875) ankyrin repeat domain 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133475 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077421 MISSION® esiRNA esiRNA targeting mouse Ankrd24 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133475 Rosetta Predictions human pricing
XM_114000 Rosetta Predictions human pricing
NM_001106771 Rosetta Predictions rat pricing
NM_027480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363188 predicted 824
2 SASI_Hs02_00363189 predicted 1217
3 SASI_Hs02_00363190 predicted 773
4 SASI_Hs02_00363191 predicted 3666
5 SASI_Hs02_00363192 predicted 774
6 SASI_Hs02_00363193 predicted 574
7 SASI_Hs02_00363194 predicted 802
8 SASI_Hs02_00363195 predicted 3450
9 SASI_Hs02_00363196 predicted 1147
10 SASI_Hs02_00363197 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276202 predicted 663
2 SASI_Hs01_00276203 predicted 1060
3 SASI_Hs01_00276204 predicted 3299
4 SASI_Hs01_00276205 predicted 610
5 SASI_Hs01_00276206 predicted 3509
6 SASI_Hs01_00276207 predicted 609
7 SASI_Hs01_00276208 predicted 412
8 SASI_Hs01_00276209 predicted 3288
9 SASI_Hs01_00276210 predicted 638
10 SASI_Hs01_00276211 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222238 predicted 1658
2 SASI_Rn02_00222239 predicted 1594
3 SASI_Rn02_00222240 predicted 1833
4 SASI_Rn02_00222241 predicted 1332
5 SASI_Rn02_00222242 predicted 1259
6 SASI_Rn02_00222243 predicted 3154
7 SASI_Rn02_00222244 predicted 922
8 SASI_Rn02_00222245 predicted 1958
9 SASI_Rn02_00222246 predicted 2278
10 SASI_Rn02_00222247 predicted 2046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177624 predicted 1735
2 SASI_Mm01_00177625 predicted 3006
3 SASI_Mm01_00177626 predicted 2011
4 SASI_Mm01_00177627 predicted 1663
5 SASI_Mm01_00177628 predicted 1670
6 SASI_Mm01_00177629 predicted 855
7 SASI_Mm01_00177630 predicted 2100
8 SASI_Mm01_00177631 predicted 443
9 SASI_Mm01_00177632 predicted 1668
10 SASI_Mm01_00177633 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027480
VALIDATED
ANKRD24 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 24
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-686s1c1
Sequence:CCGGGCTGAGGCCCTAAATGTGAAACTCGAGTTTCACATTTAGGGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-817s1c1
Sequence:CCGGCACAGGTACAGTGATTAGAAACTCGAGTTTCTAATCACTGTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-1628s1c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-505s1c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027480.1-829s1c1
Sequence:CCGGGATTAGAAACATGGAGGCCATCTCGAGATGGCCTCCATGTTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3340s21c1
Sequence:CCGGCCTGATATGCCACCTACATCACTCGAGTGATGTAGGTGGCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-328s21c1
Sequence:CCGGGCAAGTCTGCGTTCCACTTAGCTCGAGCTAAGTGGAACGCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1739s21c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3289s21c1
Sequence:CCGGTATAGTCTGTTCCTCTGATTCCTCGAGGAATCAGAGGAACAGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-2862s21c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1914s21c1
Sequence:CCGGACTATGGCTGAGGCCCTAAATCTCGAGATTTAGGGCCTCAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027480
VALIDATED
ANKRD24 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 24
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-686s1c1
Sequence:CCGGGCTGAGGCCCTAAATGTGAAACTCGAGTTTCACATTTAGGGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-817s1c1
Sequence:CCGGCACAGGTACAGTGATTAGAAACTCGAGTTTCTAATCACTGTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-1628s1c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-505s1c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027480.1-829s1c1
Sequence:CCGGGATTAGAAACATGGAGGCCATCTCGAGATGGCCTCCATGTTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3340s21c1
Sequence:CCGGCCTGATATGCCACCTACATCACTCGAGTGATGTAGGTGGCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-328s21c1
Sequence:CCGGGCAAGTCTGCGTTCCACTTAGCTCGAGCTAAGTGGAACGCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1739s21c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3289s21c1
Sequence:CCGGTATAGTCTGTTCCTCTGATTCCTCGAGGAATCAGAGGAACAGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-2862s21c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1914s21c1
Sequence:CCGGACTATGGCTGAGGCCCTAAATCTCGAGATTTAGGGCCTCAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027480
VALIDATED
ANKRD24 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 24
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-686s1c1
Sequence:CCGGGCTGAGGCCCTAAATGTGAAACTCGAGTTTCACATTTAGGGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027480.1-817s1c1
Sequence:CCGGCACAGGTACAGTGATTAGAAACTCGAGTTTCTAATCACTGTACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-1628s1c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027480.1-505s1c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027480.1-829s1c1
Sequence:CCGGGATTAGAAACATGGAGGCCATCTCGAGATGGCCTCCATGTTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3340s21c1
Sequence:CCGGCCTGATATGCCACCTACATCACTCGAGTGATGTAGGTGGCATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-328s21c1
Sequence:CCGGGCAAGTCTGCGTTCCACTTAGCTCGAGCTAAGTGGAACGCAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1739s21c1
Sequence:CCGGCACCACATATGCAGAAACCAACTCGAGTTGGTTTCTGCATATGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-3289s21c1
Sequence:CCGGTATAGTCTGTTCCTCTGATTCCTCGAGGAATCAGAGGAACAGACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027480.2-2862s21c1
Sequence:CCGGGACCTGTCCAAAGAAGTCTTTCTCGAGAAAGACTTCTTTGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027480.2-1914s21c1
Sequence:CCGGACTATGGCTGAGGCCCTAAATCTCGAGATTTAGGGCCTCAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133475
ANKRD24 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3462s21c1
Sequence:CCGGCAAAGAAGTCTTCAATCTTAACTCGAGTTAAGATTGAAGACTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1898s21c1
Sequence:CCGGCAACCCACATGGAGCTAAATGCTCGAGCATTTAGCTCCATGTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133475.1-3801s21c1
Sequence:CCGGTTGGCTTCACTTGGCCCTATCCTCGAGGATAGGGCCAAGTGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3539s21c1
Sequence:CCGGGTGACCAGGTGAAGGATTTACCTCGAGGTAAATCCTTCACCTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1135s21c1
Sequence:CCGGGCGTCATCTCAGAACTCTATGCTCGAGCATAGAGTTCTGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133475
ANKRD24 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3462s21c1
Sequence:CCGGCAAAGAAGTCTTCAATCTTAACTCGAGTTAAGATTGAAGACTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1898s21c1
Sequence:CCGGCAACCCACATGGAGCTAAATGCTCGAGCATTTAGCTCCATGTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133475.1-3801s21c1
Sequence:CCGGTTGGCTTCACTTGGCCCTATCCTCGAGGATAGGGCCAAGTGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3539s21c1
Sequence:CCGGGTGACCAGGTGAAGGATTTACCTCGAGGTAAATCCTTCACCTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1135s21c1
Sequence:CCGGGCGTCATCTCAGAACTCTATGCTCGAGCATAGAGTTCTGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133475
ANKRD24 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3462s21c1
Sequence:CCGGCAAAGAAGTCTTCAATCTTAACTCGAGTTAAGATTGAAGACTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1898s21c1
Sequence:CCGGCAACCCACATGGAGCTAAATGCTCGAGCATTTAGCTCCATGTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133475.1-3801s21c1
Sequence:CCGGTTGGCTTCACTTGGCCCTATCCTCGAGGATAGGGCCAAGTGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-3539s21c1
Sequence:CCGGGTGACCAGGTGAAGGATTTACCTCGAGGTAAATCCTTCACCTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133475.1-1135s21c1
Sequence:CCGGGCGTCATCTCAGAACTCTATGCTCGAGCATAGAGTTCTGAGATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks