EMAIL THIS PAGE TO A FRIEND

ANKRD26

ankyrin repeat domain 26

68 Gene Product Result for
Synonyms: THC2 bA145E8.1
Gene ID:
Human(22852) Summary: This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(232339) ankyrin repeat domain 26
Rat(312667) ankyrin repeat domain 26
Domestic Rabbit(100351681) ankyrin repeat domain 26
domestic guinea pig(100732270) ankyrin repeat domain 26
chicken(417764) ankyrin repeat domain 26
cow(533620) ankyrin repeat domain 26
Horse(100055504) ankyrin repeat domain 26
domestic cat(101087752) ankyrin repeat domain 26
dog(480753) ankyrin repeat domain 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014915 Rosetta Predictions human pricing
XM_001057458 Rosetta Predictions rat pricing
XM_232319 Rosetta Predictions rat pricing
NM_001081112 Rosetta Predictions mouse pricing
XM_132817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112864 predicted 4895
2 SASI_Hs01_00112865 predicted 4029
3 SASI_Hs02_00346558 predicted 614
4 SASI_Hs01_00112866 predicted 1135
5 SASI_Hs01_00112868 predicted 564
6 SASI_Hs02_00346559 predicted 3387
7 SASI_Hs01_00112869 predicted 1458
8 SASI_Hs02_00346560 predicted 5207
9 SASI_Hs01_00112870 predicted 1399
10 SASI_Hs02_00346561 predicted 5179
11 SASI_Hs01_00112867 predicted 1370
12 SASI_Hs01_00112871 predicted 1351
13 SASI_Hs01_00112872 predicted 3972
14 SASI_Hs01_00112873 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286430 predicted 4700
2 SASI_Rn02_00286431 predicted 2712
3 SASI_Rn02_00286432 predicted 3725
4 SASI_Rn02_00286433 predicted 1217
5 SASI_Rn02_00286434 predicted 4983
6 SASI_Rn02_00286435 predicted 2008
7 SASI_Rn02_00286436 predicted 894
8 SASI_Rn02_00286437 predicted 1300
9 SASI_Rn02_00286438 predicted 3621
10 SASI_Rn02_00286439 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387061 predicted 4697
2 SASI_Rn02_00387062 predicted 2710
3 SASI_Rn02_00387063 predicted 3727
4 SASI_Rn02_00387064 predicted 4175
5 SASI_Rn02_00387065 predicted 4978
6 SASI_Rn02_00387066 predicted 3769
7 SASI_Rn02_00387067 predicted 3626
8 SASI_Rn02_00387068 predicted 3037
9 SASI_Rn02_00387069 predicted 3937
10 SASI_Rn02_00387070 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295301 predicted 738
2 SASI_Mm02_00295302 predicted 381
3 SASI_Mm02_00295303 predicted 3246
4 SASI_Mm02_00295304 predicted 2261
5 SASI_Mm02_00295305 predicted 3220
6 SASI_Mm02_00295306 predicted 4663
7 SASI_Mm02_00295307 predicted 916
8 SASI_Mm02_00295308 predicted 3360
9 SASI_Mm02_00295309 predicted 2773
10 SASI_Mm02_00295310 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241557 predicted 745
2 SASI_Mm01_00241558 predicted 378
3 SASI_Mm01_00241559 predicted 3255
4 SASI_Mm01_00241560 predicted 3225
5 SASI_Mm01_00241561 predicted 4661
6 SASI_Mm01_00241562 predicted 926
7 SASI_Mm01_00241563 predicted 2735
8 SASI_Mm01_00241564 predicted 2670
9 SASI_Mm01_00241565 predicted 2780
10 SASI_Mm01_00241566 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081112
VALIDATED
ANKRD26 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 26
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5295s21c1
Sequence:CCGGGAGAGGATCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGATCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-924s21c1
Sequence:GTACCGGGCTCTTTAACCAGGTCTTATACTCGAGTATAAGACCTGGTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5460s21c1
Sequence:CCGGGTCATAATGGAACCTACTATTCTCGAGAATAGTAGGTTCCATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-4303s21c1
Sequence:CCGGTATCCCAGTTAGTACACTAATCTCGAGATTAGTGTACTAACTGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3268s21c1
Sequence:CCGGTATGTCTAACCTCCGAGATAACTCGAGTTATCTCGGAGGTTAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-2157s21c1
Sequence:CCGGTGGACAACCTTGACGACTTTACTCGAGTAAAGTCGTCAAGGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3163s21c1
Sequence:CCGGTCTGCATGATCACGCTGAAATCTCGAGATTTCAGCGTGATCATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3379s21c1
Sequence:CCGGAGAGAAGACGCTGGCGTTAAACTCGAGTTTAACGCCAGCGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3033s21c1
Sequence:CCGGAGTATACTGGACAGCTTAATACTCGAGTATTAAGCTGTCCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-3851s21c1
Sequence:CCGGTCCCGCTACCGCAGCAATTTACTCGAGTAAATTGCTGCGGTAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081112
VALIDATED
ANKRD26 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 26
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5295s21c1
Sequence:CCGGGAGAGGATCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGATCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-924s21c1
Sequence:GTACCGGGCTCTTTAACCAGGTCTTATACTCGAGTATAAGACCTGGTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5460s21c1
Sequence:CCGGGTCATAATGGAACCTACTATTCTCGAGAATAGTAGGTTCCATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-4303s21c1
Sequence:CCGGTATCCCAGTTAGTACACTAATCTCGAGATTAGTGTACTAACTGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3268s21c1
Sequence:CCGGTATGTCTAACCTCCGAGATAACTCGAGTTATCTCGGAGGTTAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-2157s21c1
Sequence:CCGGTGGACAACCTTGACGACTTTACTCGAGTAAAGTCGTCAAGGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3163s21c1
Sequence:CCGGTCTGCATGATCACGCTGAAATCTCGAGATTTCAGCGTGATCATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3379s21c1
Sequence:CCGGAGAGAAGACGCTGGCGTTAAACTCGAGTTTAACGCCAGCGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3033s21c1
Sequence:CCGGAGTATACTGGACAGCTTAATACTCGAGTATTAAGCTGTCCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-3851s21c1
Sequence:CCGGTCCCGCTACCGCAGCAATTTACTCGAGTAAATTGCTGCGGTAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081112
VALIDATED
ANKRD26 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 26
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5295s21c1
Sequence:CCGGGAGAGGATCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGATCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-924s21c1
Sequence:GTACCGGGCTCTTTAACCAGGTCTTATACTCGAGTATAAGACCTGGTTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-5460s21c1
Sequence:CCGGGTCATAATGGAACCTACTATTCTCGAGAATAGTAGGTTCCATTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-4303s21c1
Sequence:CCGGTATCCCAGTTAGTACACTAATCTCGAGATTAGTGTACTAACTGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3268s21c1
Sequence:CCGGTATGTCTAACCTCCGAGATAACTCGAGTTATCTCGGAGGTTAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-2157s21c1
Sequence:CCGGTGGACAACCTTGACGACTTTACTCGAGTAAAGTCGTCAAGGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3163s21c1
Sequence:CCGGTCTGCATGATCACGCTGAAATCTCGAGATTTCAGCGTGATCATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3379s21c1
Sequence:CCGGAGAGAAGACGCTGGCGTTAAACTCGAGTTTAACGCCAGCGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081112.1-3033s21c1
Sequence:CCGGAGTATACTGGACAGCTTAATACTCGAGTATTAAGCTGTCCAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081112.1-3851s21c1
Sequence:CCGGTCCCGCTACCGCAGCAATTTACTCGAGTAAATTGCTGCGGTAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014915
ANKRD26 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-462s1c1
Sequence:CCGGCCAGCTCAATGTCTGTGACAACTCGAGTTGTCACAGACATTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1116s1c1
Sequence:CCGGCCTTCCTACAACATCAATCAACTCGAGTTGATTGATGTTGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-3050s1c1
Sequence:CCGGCACAAACAATATCCCAGTATACTCGAGTATACTGGGATATTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1376s1c1
Sequence:CCGGGATTAGGACAAGAGGAAGATACTCGAGTATCTTCCTCTTGTCCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-4681s1c1
Sequence:CCGGGAGCAGTTTAGAGAGAATAATCTCGAGATTATTCTCTCTAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-5155s1c1
Sequence:CCGGGAATTGGAATCTGGATCAATACTCGAGTATTGATCCAGATTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-2419s1c1
Sequence:CCGGGACAAGGTTAATGTACTACAACTCGAGTTGTAGTACATTAACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-366s1c1
Sequence:CCGGCTTGAACGATAGAGACAAGATCTCGAGATCTTGTCTCTATCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-1852s1c1
Sequence:CCGGGCTACTGATGATGCTGAAGATCTCGAGATCTTCAGCATCATCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-629s1c1
Sequence:CCGGCAGTAGCAACAAAGCTGCTTTCTCGAGAAAGCAGCTTTGTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014915
ANKRD26 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-462s1c1
Sequence:CCGGCCAGCTCAATGTCTGTGACAACTCGAGTTGTCACAGACATTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1116s1c1
Sequence:CCGGCCTTCCTACAACATCAATCAACTCGAGTTGATTGATGTTGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-3050s1c1
Sequence:CCGGCACAAACAATATCCCAGTATACTCGAGTATACTGGGATATTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1376s1c1
Sequence:CCGGGATTAGGACAAGAGGAAGATACTCGAGTATCTTCCTCTTGTCCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-4681s1c1
Sequence:CCGGGAGCAGTTTAGAGAGAATAATCTCGAGATTATTCTCTCTAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-5155s1c1
Sequence:CCGGGAATTGGAATCTGGATCAATACTCGAGTATTGATCCAGATTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-2419s1c1
Sequence:CCGGGACAAGGTTAATGTACTACAACTCGAGTTGTAGTACATTAACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-366s1c1
Sequence:CCGGCTTGAACGATAGAGACAAGATCTCGAGATCTTGTCTCTATCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-1852s1c1
Sequence:CCGGGCTACTGATGATGCTGAAGATCTCGAGATCTTCAGCATCATCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-629s1c1
Sequence:CCGGCAGTAGCAACAAAGCTGCTTTCTCGAGAAAGCAGCTTTGTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014915
ANKRD26 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-462s1c1
Sequence:CCGGCCAGCTCAATGTCTGTGACAACTCGAGTTGTCACAGACATTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1116s1c1
Sequence:CCGGCCTTCCTACAACATCAATCAACTCGAGTTGATTGATGTTGTAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-3050s1c1
Sequence:CCGGCACAAACAATATCCCAGTATACTCGAGTATACTGGGATATTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-1376s1c1
Sequence:CCGGGATTAGGACAAGAGGAAGATACTCGAGTATCTTCCTCTTGTCCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-4681s1c1
Sequence:CCGGGAGCAGTTTAGAGAGAATAATCTCGAGATTATTCTCTCTAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-5155s1c1
Sequence:CCGGGAATTGGAATCTGGATCAATACTCGAGTATTGATCCAGATTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014915.1-2419s1c1
Sequence:CCGGGACAAGGTTAATGTACTACAACTCGAGTTGTAGTACATTAACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-366s1c1
Sequence:CCGGCTTGAACGATAGAGACAAGATCTCGAGATCTTGTCTCTATCGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-1852s1c1
Sequence:CCGGGCTACTGATGATGCTGAAGATCTCGAGATCTTCAGCATCATCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014915.1-629s1c1
Sequence:CCGGCAGTAGCAACAAAGCTGCTTTCTCGAGAAAGCAGCTTTGTTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks