EMAIL THIS PAGE TO A FRIEND

ANKRD26P1

ankyrin repeat domain 26 pseudogene 1

43 Gene Product Result for
Species: Human ANKRD26P1(124149)
UniProtKB ID: Q6NSI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004299 Rosetta Predictions human pricing
XR_040027 Rosetta Predictions human pricing
XR_040028 Rosetta Predictions human pricing
XR_040029 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189138 predicted 1024
2 SASI_Hs01_00189139 predicted 822
3 SASI_Hs01_00189140 predicted 889
4 SASI_Hs01_00189141 predicted 624
5 SASI_Hs01_00189142 predicted 830
6 SASI_Hs01_00189143 predicted 726
7 SASI_Hs01_00189144 predicted 1119
8 SASI_Hs01_00189145 predicted 542
9 SASI_Hs01_00189146 predicted 632
10 SASI_Hs01_00189147 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515283 predicted 1562
2 SASI_Hs02_00515284 predicted 1488
3 SASI_Hs02_00515285 predicted 1748
4 SASI_Hs02_00515286 predicted 334
5 SASI_Hs02_00515287 predicted 1433
6 SASI_Hs02_00515288 predicted 200
7 SASI_Hs02_00515289 predicted 1847
8 SASI_Hs02_00515290 predicted 1657
9 SASI_Hs02_00515291 predicted 1379
10 SASI_Hs02_00515292 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515293 predicted 1570
2 SASI_Hs02_00515294 predicted 1483
3 SASI_Hs02_00515295 predicted 1748
4 SASI_Hs02_00515296 predicted 340
5 SASI_Hs02_00515297 predicted 1441
6 SASI_Hs02_00515298 predicted 192
7 SASI_Hs02_00515299 predicted 1843
8 SASI_Hs02_00515300 predicted 1653
9 SASI_Hs02_00515301 predicted 1377
10 SASI_Hs02_00515302 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515303 predicted 1569
2 SASI_Hs02_00515304 predicted 1489
3 SASI_Hs02_00515305 predicted 1744
4 SASI_Hs02_00515306 predicted 341
5 SASI_Hs02_00515307 predicted 1436
6 SASI_Hs02_00515308 predicted 200
7 SASI_Hs02_00515309 predicted 1844
8 SASI_Hs02_00515310 predicted 1659
9 SASI_Hs02_00515311 predicted 1378
10 SASI_Hs02_00515312 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004299
ANKRD26P1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 26 pseudogene 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1113s1c1
Sequence:CCGGGCTCCACAAGAGCACACAAATCTCGAGATTTGTGTGCTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-305s1c1
Sequence:CCGGCGGGTACAATATCCAAGAGAACTCGAGTTCTCTTGGATATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1011s1c1
Sequence:CCGGCGACCTATGTCAGCTAATGAACTCGAGTTCATTAGCTGACATAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-2239s1c1
Sequence:CCGGCGGAGGAAAGAAATTGAACAACTCGAGTTGTTCAATTTCTTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1021s1c1
Sequence:CCGGCAGCTAATGAAGACTTTGATTCTCGAGAATCAAAGTCTTCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3131s1c1
Sequence:CCGGCGGACTGTAATACAACAGAATCTCGAGATTCTGTTGTATTACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-818s1c1
Sequence:CCGGGCTTGAAAGCATTCACCAAGTCTCGAGACTTGGTGAATGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-861s1c1
Sequence:CCGGGAGACACCTAGAAATCCTCAACTCGAGTTGAGGATTTCTAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3130s1c1
Sequence:CCGGGCGGACTGTAATACAACAGAACTCGAGTTCTGTTGTATTACAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-465s1c1
Sequence:CCGGCATCCAGAAGTGGTAGCTCTTCTCGAGAAGAGCTACCACTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-300s1c1
Sequence:CCGGCAGTGCGGGTACAATATCCAACTCGAGTTGGATATTGTACCCGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-833s1c1
Sequence:CCGGCCAAGTAATGTCTGAATACAACTCGAGTTGTATTCAGACATTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-810s1c1
Sequence:CCGGGCAGTTAAGCTTGAAAGCATTCTCGAGAATGCTTTCAAGCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-611s1c1
Sequence:CCGGCCTTCCAGATGTCTATGGCAACTCGAGTTGCCATAGACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004299
ANKRD26P1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 26 pseudogene 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1113s1c1
Sequence:CCGGGCTCCACAAGAGCACACAAATCTCGAGATTTGTGTGCTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-305s1c1
Sequence:CCGGCGGGTACAATATCCAAGAGAACTCGAGTTCTCTTGGATATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1011s1c1
Sequence:CCGGCGACCTATGTCAGCTAATGAACTCGAGTTCATTAGCTGACATAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-2239s1c1
Sequence:CCGGCGGAGGAAAGAAATTGAACAACTCGAGTTGTTCAATTTCTTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1021s1c1
Sequence:CCGGCAGCTAATGAAGACTTTGATTCTCGAGAATCAAAGTCTTCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3131s1c1
Sequence:CCGGCGGACTGTAATACAACAGAATCTCGAGATTCTGTTGTATTACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-818s1c1
Sequence:CCGGGCTTGAAAGCATTCACCAAGTCTCGAGACTTGGTGAATGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-861s1c1
Sequence:CCGGGAGACACCTAGAAATCCTCAACTCGAGTTGAGGATTTCTAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3130s1c1
Sequence:CCGGGCGGACTGTAATACAACAGAACTCGAGTTCTGTTGTATTACAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-465s1c1
Sequence:CCGGCATCCAGAAGTGGTAGCTCTTCTCGAGAAGAGCTACCACTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-300s1c1
Sequence:CCGGCAGTGCGGGTACAATATCCAACTCGAGTTGGATATTGTACCCGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-833s1c1
Sequence:CCGGCCAAGTAATGTCTGAATACAACTCGAGTTGTATTCAGACATTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-810s1c1
Sequence:CCGGGCAGTTAAGCTTGAAAGCATTCTCGAGAATGCTTTCAAGCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-611s1c1
Sequence:CCGGCCTTCCAGATGTCTATGGCAACTCGAGTTGCCATAGACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004299
ANKRD26P1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 26 pseudogene 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1113s1c1
Sequence:CCGGGCTCCACAAGAGCACACAAATCTCGAGATTTGTGTGCTCTTGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-305s1c1
Sequence:CCGGCGGGTACAATATCCAAGAGAACTCGAGTTCTCTTGGATATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1011s1c1
Sequence:CCGGCGACCTATGTCAGCTAATGAACTCGAGTTCATTAGCTGACATAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-2239s1c1
Sequence:CCGGCGGAGGAAAGAAATTGAACAACTCGAGTTGTTCAATTTCTTTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-1021s1c1
Sequence:CCGGCAGCTAATGAAGACTTTGATTCTCGAGAATCAAAGTCTTCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160516    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3131s1c1
Sequence:CCGGCGGACTGTAATACAACAGAATCTCGAGATTCTGTTGTATTACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-818s1c1
Sequence:CCGGGCTTGAAAGCATTCACCAAGTCTCGAGACTTGGTGAATGCTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-861s1c1
Sequence:CCGGGAGACACCTAGAAATCCTCAACTCGAGTTGAGGATTTCTAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161411    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004299.1-3130s1c1
Sequence:CCGGGCGGACTGTAATACAACAGAACTCGAGTTCTGTTGTATTACAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-465s1c1
Sequence:CCGGCATCCAGAAGTGGTAGCTCTTCTCGAGAAGAGCTACCACTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-300s1c1
Sequence:CCGGCAGTGCGGGTACAATATCCAACTCGAGTTGGATATTGTACCCGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-833s1c1
Sequence:CCGGCCAAGTAATGTCTGAATACAACTCGAGTTGTATTCAGACATTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-810s1c1
Sequence:CCGGGCAGTTAAGCTTGAAAGCATTCTCGAGAATGCTTTCAAGCTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004299.1-611s1c1
Sequence:CCGGCCTTCCAGATGTCTATGGCAACTCGAGTTGCCATAGACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks