EMAIL THIS PAGE TO A FRIEND

ANKRD27

ankyrin repeat domain 27 (VPS9 domain)

122 Gene Product Result for
Synonyms: VARP
UniProtKB ID: Q96NW4, Q71MF5, Q86UC3, Q8ND80, Q9H0I4
Gene ID:
Mouse(245886) ankyrin repeat domain 27 (VPS9 domain)
Rat(361555) ankyrin repeat domain 27 (VPS9 domain)
chicken(415766) ankyrin repeat domain 27 (VPS9 domain)
domestic cat(101084669) ankyrin repeat domain 27 (VPS9 domain)
cow(784749) ankyrin repeat domain 27 (VPS9 domain)
dog(484603) ankyrin repeat domain 27 (VPS9 domain)
domestic guinea pig(100725904) ankyrin repeat domain 27 (VPS9 domain)
naked mole-rat(101697235) ankyrin repeat domain 27 (VPS9 domain)
sheep(101108593) ankyrin repeat domain 27 (VPS9 domain)
Domestic Rabbit(100349793) ankyrin repeat domain 27 (VPS9 domain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032139 Rosetta Predictions human pricing
XM_001079798 Rosetta Predictions rat pricing
XM_341843 Rosetta Predictions rat pricing
NM_145633 Rosetta Predictions mouse pricing
NM_178263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097808 predicted 2658
2 SASI_Hs02_00359365 predicted 1214
3 SASI_Hs01_00097809 predicted 1952
4 SASI_Hs01_00097811 predicted 3024
5 SASI_Hs01_00097813 predicted 2319
6 SASI_Hs01_00097814 predicted 1220
7 SASI_Hs02_00359366 predicted 3321
8 SASI_Hs01_00097816 predicted 2150
9 SASI_Hs01_00097817 predicted 2886
10 SASI_Hs02_00359367 predicted 1892
11 SASI_Hs01_00097810 predicted 862
12 SASI_Hs01_00097812 predicted 1167
13 SASI_Hs01_00097815 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365528 predicted 1028
2 SASI_Rn02_00365529 predicted 1057
3 SASI_Rn02_00365530 predicted 1881
4 SASI_Rn02_00365531 predicted 279
5 SASI_Rn02_00365532 predicted 1067
6 SASI_Rn02_00365533 predicted 1803
7 SASI_Rn02_00365534 predicted 727
8 SASI_Rn02_00365535 predicted 804
9 SASI_Rn02_00365536 predicted 1747
10 SASI_Rn02_00365537 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393463 predicted 1033
2 SASI_Rn02_00393464 predicted 1096
3 SASI_Rn02_00393465 predicted 1062
4 SASI_Rn02_00393466 predicted 1068
5 SASI_Rn02_00393467 predicted 1025
6 SASI_Rn02_00393468 predicted 1053
7 SASI_Rn02_00393469 predicted 1007
8 SASI_Rn02_00393470 predicted 1066
9 SASI_Rn02_00393471 predicted 1027
10 SASI_Rn02_00393472 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341218 predicted 440
2 SASI_Mm01_00114104 predicted 556
3 SASI_Mm02_00341219 predicted 342
4 SASI_Mm02_00341220 predicted 783
5 SASI_Mm02_00341221 predicted 339
6 SASI_Mm01_00114111 predicted 648
7 SASI_Mm02_00341222 predicted 338
8 SASI_Mm02_00341223 predicted 459
9 SASI_Mm02_00341224 predicted 900
10 SASI_Mm02_00341225 predicted 784
11 SASI_Mm01_00114105 predicted 578
12 SASI_Mm01_00114106 predicted 777
13 SASI_Mm01_00114107 predicted 557
14 SASI_Mm01_00114108 predicted 775
15 SASI_Mm01_00114109 predicted 547
16 SASI_Mm01_00114110 predicted 871
17 SASI_Mm01_00114112 predicted 503
18 SASI_Mm01_00114113 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348690 predicted 438
2 SASI_Mm01_00062075 predicted 553
3 SASI_Mm01_00062078 predicted 346
4 SASI_Mm02_00348691 predicted 789
5 SASI_Mm01_00062080 predicted 338
6 SASI_Mm01_00062082 predicted 650
7 SASI_Mm02_00348692 predicted 340
8 SASI_Mm02_00348693 predicted 459
9 SASI_Mm02_00348694 predicted 896
10 SASI_Mm02_00348695 predicted 786
11 SASI_Mm01_00062076 predicted 1183
12 SASI_Mm01_00062077 predicted 1130
13 SASI_Mm01_00062079 predicted 561
14 SASI_Mm01_00062081 predicted 1234
15 SASI_Mm01_00062083 predicted 503
16 SASI_Mm01_00062084 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032139
VALIDATED
ANKRD27 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 27 (VPS9 domain)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032139.1-274s1c1
Sequence:CCGGCCAGTCTACTTGTCAGTTTGACTCGAGTCAAACTGACAAGTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3322s1c1
Sequence:CCGGGCAAGGATGCAACAAGATGATCTCGAGATCATCTTGTTGCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-2822s1c1
Sequence:CCGGCCAAGCTGTGTTGCTTCATTACTCGAGTAATGAAGCAACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3701s1c1
Sequence:CCGGGCTGGAGAGAAGTAAGTAATTCTCGAGAATTACTTACTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032139.1-1349s1c1
Sequence:CCGGGCATCAGGTAACCAGAAAGAACTCGAGTTCTTTCTGGTTACCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-905s1c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-1105s1c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032139.1-3349s1c1
Sequence:CCGGCGTGAACACATCTGAGAACTACTCGAGTAGTTCTCAGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-928s21c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-1128s21c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032139.2-3704s21c1
Sequence:CCGGATTCCTCCACCTAGGATTAAGCTCGAGCTTAATCCTAGGTGGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-379s21c1
Sequence:CCGGATTCAAGGGAACAGGATTAAACTCGAGTTTAATCCTGTTCCCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-633s21c1
Sequence:CCGGCCATCGAACATTCCGAGAATGCTCGAGCATTCTCGGAATGTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032139
VALIDATED
ANKRD27 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 27 (VPS9 domain)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032139.1-274s1c1
Sequence:CCGGCCAGTCTACTTGTCAGTTTGACTCGAGTCAAACTGACAAGTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3322s1c1
Sequence:CCGGGCAAGGATGCAACAAGATGATCTCGAGATCATCTTGTTGCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-2822s1c1
Sequence:CCGGCCAAGCTGTGTTGCTTCATTACTCGAGTAATGAAGCAACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3701s1c1
Sequence:CCGGGCTGGAGAGAAGTAAGTAATTCTCGAGAATTACTTACTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032139.1-1349s1c1
Sequence:CCGGGCATCAGGTAACCAGAAAGAACTCGAGTTCTTTCTGGTTACCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-905s1c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-1105s1c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032139.1-3349s1c1
Sequence:CCGGCGTGAACACATCTGAGAACTACTCGAGTAGTTCTCAGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-928s21c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-1128s21c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032139.2-3704s21c1
Sequence:CCGGATTCCTCCACCTAGGATTAAGCTCGAGCTTAATCCTAGGTGGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-379s21c1
Sequence:CCGGATTCAAGGGAACAGGATTAAACTCGAGTTTAATCCTGTTCCCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-633s21c1
Sequence:CCGGCCATCGAACATTCCGAGAATGCTCGAGCATTCTCGGAATGTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032139
VALIDATED
ANKRD27 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 27 (VPS9 domain)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032139.1-274s1c1
Sequence:CCGGCCAGTCTACTTGTCAGTTTGACTCGAGTCAAACTGACAAGTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3322s1c1
Sequence:CCGGGCAAGGATGCAACAAGATGATCTCGAGATCATCTTGTTGCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-2822s1c1
Sequence:CCGGCCAAGCTGTGTTGCTTCATTACTCGAGTAATGAAGCAACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032139.1-3701s1c1
Sequence:CCGGGCTGGAGAGAAGTAAGTAATTCTCGAGAATTACTTACTTCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032139.1-1349s1c1
Sequence:CCGGGCATCAGGTAACCAGAAAGAACTCGAGTTCTTTCTGGTTACCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-905s1c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032139.1-1105s1c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032139.1-3349s1c1
Sequence:CCGGCGTGAACACATCTGAGAACTACTCGAGTAGTTCTCAGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-928s21c1
Sequence:CCGGCCGGAGTTCAGCTTTAACATACTCGAGTATGTTAAAGCTGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-1128s21c1
Sequence:CCGGGATCCCTAATTGGATGGCAAACTCGAGTTTGCCATCCAATTAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032139.2-3704s21c1
Sequence:CCGGATTCCTCCACCTAGGATTAAGCTCGAGCTTAATCCTAGGTGGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-379s21c1
Sequence:CCGGATTCAAGGGAACAGGATTAAACTCGAGTTTAATCCTGTTCCCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032139.2-633s21c1
Sequence:CCGGCCATCGAACATTCCGAGAATGCTCGAGCATTCTCGGAATGTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145633
VALIDATED
ANKRD27 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 27 (VPS9 domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1812s21c1
Sequence:CCGGCAGGCCTGCAGATTGGATATTCTCGAGAATATCCAATCTGCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-794s21c1
Sequence:CCGGGTATGTCCATCACGATATTTACTCGAGTAAATATCGTGATGGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-670s21c1
Sequence:CCGGACCACATAGACTCCGTAAATGCTCGAGCATTTACGGAGTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1279s21c1
Sequence:CCGGGATTTGGCGACAGACTATTTCCTCGAGGAAATAGTCTGTCGCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-3956s21c1
Sequence:CCGGCTTAAGTCTTTCGATTCAAATCTCGAGATTTGAATCGAAAGACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145633
VALIDATED
ANKRD27 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 27 (VPS9 domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1812s21c1
Sequence:CCGGCAGGCCTGCAGATTGGATATTCTCGAGAATATCCAATCTGCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-794s21c1
Sequence:CCGGGTATGTCCATCACGATATTTACTCGAGTAAATATCGTGATGGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-670s21c1
Sequence:CCGGACCACATAGACTCCGTAAATGCTCGAGCATTTACGGAGTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1279s21c1
Sequence:CCGGGATTTGGCGACAGACTATTTCCTCGAGGAAATAGTCTGTCGCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-3956s21c1
Sequence:CCGGCTTAAGTCTTTCGATTCAAATCTCGAGATTTGAATCGAAAGACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145633
VALIDATED
ANKRD27 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 27 (VPS9 domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1812s21c1
Sequence:CCGGCAGGCCTGCAGATTGGATATTCTCGAGAATATCCAATCTGCAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-794s21c1
Sequence:CCGGGTATGTCCATCACGATATTTACTCGAGTAAATATCGTGATGGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-670s21c1
Sequence:CCGGACCACATAGACTCCGTAAATGCTCGAGCATTTACGGAGTCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-1279s21c1
Sequence:CCGGGATTTGGCGACAGACTATTTCCTCGAGGAAATAGTCTGTCGCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145633.3-3956s21c1
Sequence:CCGGCTTAAGTCTTTCGATTCAAATCTCGAGATTTGAATCGAAAGACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks