EMAIL THIS PAGE TO A FRIEND

ANKRD28

ankyrin repeat domain 28

265 Gene Product Result for
Synonyms: PITK PPP1R65
Gene ID:
Mouse(105522) ankyrin repeat domain 28
Rat(306264) ankyrin repeat domain 28
sheep(101119271) ankyrin repeat domain 28
Domestic Rabbit(100343070) ankyrin repeat domain 28
naked mole-rat(101718420) ankyrin repeat domain 28
domestic guinea pig(100726446) ankyrin repeat domain 28
chicken(420640) ankyrin repeat domain 28
cow(529062) ankyrin repeat domain 28
Horse(100052418) ankyrin repeat domain 28
domestic cat(101094534) ankyrin repeat domain 28
dog(477058) ankyrin repeat domain 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015199 Rosetta Predictions human pricing
XM_001057585 Rosetta Predictions rat pricing
XM_001057687 Rosetta Predictions rat pricing
XM_001057751 Rosetta Predictions rat pricing
XM_224620 Rosetta Predictions rat pricing
NM_001024604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173856 predicted 2398
2 SASI_Hs01_00173857 predicted 967
3 SASI_Hs01_00173858 predicted 2982
4 SASI_Hs01_00173859 predicted 1679
5 SASI_Hs01_00173860 predicted 1408
6 SASI_Hs02_00347279 predicted 1567
7 SASI_Hs02_00347280 predicted 1389
8 SASI_Hs01_00173864 predicted 521
9 SASI_Hs02_00347281 predicted 790
10 SASI_Hs02_00347282 predicted 887
11 SASI_Hs01_00173861 predicted 624
12 SASI_Hs01_00173862 predicted 3327
13 SASI_Hs01_00173863 predicted 3203
14 SASI_Hs01_00173865 predicted 2824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286864 predicted 391
2 SASI_Rn02_00286865 predicted 918
3 SASI_Rn02_00286866 predicted 2777
4 SASI_Rn02_00286867 predicted 2692
5 SASI_Rn02_00286868 predicted 690
6 SASI_Rn02_00286869 predicted 2636
7 SASI_Rn02_00286870 predicted 1150
8 SASI_Rn02_00286871 predicted 1514
9 SASI_Rn02_00286872 predicted 1049
10 SASI_Rn02_00286873 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287209 predicted 392
2 SASI_Rn02_00287210 predicted 921
3 SASI_Rn02_00287211 predicted 3093
4 SASI_Rn02_00287212 predicted 2368
5 SASI_Rn02_00287213 predicted 682
6 SASI_Rn02_00287214 predicted 2635
7 SASI_Rn02_00287215 predicted 1156
8 SASI_Rn02_00287216 predicted 1521
9 SASI_Rn02_00287217 predicted 1045
10 SASI_Rn02_00287218 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287439 predicted 353
2 SASI_Rn02_00287440 predicted 881
3 SASI_Rn02_00287441 predicted 3047
4 SASI_Rn02_00287442 predicted 2328
5 SASI_Rn02_00287443 predicted 646
6 SASI_Rn02_00287444 predicted 2598
7 SASI_Rn02_00287445 predicted 1120
8 SASI_Rn02_00287446 predicted 1480
9 SASI_Rn02_00287447 predicted 1008
10 SASI_Rn02_00287448 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382107 predicted 351
2 SASI_Rn02_00382108 predicted 880
3 SASI_Rn02_00382109 predicted 3053
4 SASI_Rn02_00382110 predicted 2331
5 SASI_Rn02_00382111 predicted 653
6 SASI_Rn02_00382112 predicted 2605
7 SASI_Rn02_00382113 predicted 1119
8 SASI_Rn02_00382114 predicted 1479
9 SASI_Rn02_00382115 predicted 1008
10 SASI_Rn02_00382116 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167700 predicted 2162
2 SASI_Mm01_00167701 predicted 885
3 SASI_Mm01_00167702 predicted 1115
4 SASI_Mm02_00287627 predicted 1305
5 SASI_Mm01_00167703 predicted 391
6 SASI_Mm01_00167704 predicted 1486
7 SASI_Mm01_00167705 predicted 1570
8 SASI_Mm01_00167706 predicted 2363
9 SASI_Mm02_00287628 predicted 708
10 SASI_Mm01_00167707 predicted 1753
11 SASI_Mm01_00167708 predicted 724
12 SASI_Mm01_00167709 predicted 2593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024604
VALIDATED
ANKRD28 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-2593s1c1
Sequence:CCGGGCCAGAATGCTCAGGTCAATTCTCGAGAATTGACCTGAGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-1118s1c1
Sequence:CCGGGCTTCTAATCAACACTCTTATCTCGAGATAAGAGTGTTGATTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-3065s1c1
Sequence:CCGGCCGTTATACCAACACCTCAAACTCGAGTTTGAGGTGTTGGTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024604.1-4778s1c1
Sequence:CCGGGCCAAATTGAAGACTGCCTTTCTCGAGAAAGGCAGTCTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024604.1-1563s1c1
Sequence:CCGGCGGGACAAACAAGGCTATAATCTCGAGATTATAGCCTTGTTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024604
VALIDATED
ANKRD28 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-2593s1c1
Sequence:CCGGGCCAGAATGCTCAGGTCAATTCTCGAGAATTGACCTGAGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-1118s1c1
Sequence:CCGGGCTTCTAATCAACACTCTTATCTCGAGATAAGAGTGTTGATTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-3065s1c1
Sequence:CCGGCCGTTATACCAACACCTCAAACTCGAGTTTGAGGTGTTGGTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024604.1-4778s1c1
Sequence:CCGGGCCAAATTGAAGACTGCCTTTCTCGAGAAAGGCAGTCTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024604.1-1563s1c1
Sequence:CCGGCGGGACAAACAAGGCTATAATCTCGAGATTATAGCCTTGTTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024604
VALIDATED
ANKRD28 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-2593s1c1
Sequence:CCGGGCCAGAATGCTCAGGTCAATTCTCGAGAATTGACCTGAGCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-1118s1c1
Sequence:CCGGGCTTCTAATCAACACTCTTATCTCGAGATAAGAGTGTTGATTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024604.1-3065s1c1
Sequence:CCGGCCGTTATACCAACACCTCAAACTCGAGTTTGAGGTGTTGGTATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024604.1-4778s1c1
Sequence:CCGGGCCAAATTGAAGACTGCCTTTCTCGAGAAAGGCAGTCTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024604.1-1563s1c1
Sequence:CCGGCGGGACAAACAAGGCTATAATCTCGAGATTATAGCCTTGTTTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015199
VALIDATED
ANKRD28 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015199.1-467s1c1
Sequence:CCGGCTGATGAAGTTCGAGCACTAACTCGAGTTAGTGCTCGAACTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-1261s1c1
Sequence:CCGGGCATTGTGTTTAGAGCTTCTACTCGAGTAGAAGCTCTAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-2077s1c1
Sequence:CCGGGCCTATCATGGTCACCATCAACTCGAGTTGATGGTGACCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015199.1-2390s1c1
Sequence:CCGGGCATCACAGAAGGGCGTATTTCTCGAGAAATACGCCCTTCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-931s1c1
Sequence:CCGGGCTATCCATTGGGCAGCATATCTCGAGATATGCTGCCCAATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015199
VALIDATED
ANKRD28 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015199.1-467s1c1
Sequence:CCGGCTGATGAAGTTCGAGCACTAACTCGAGTTAGTGCTCGAACTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-1261s1c1
Sequence:CCGGGCATTGTGTTTAGAGCTTCTACTCGAGTAGAAGCTCTAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-2077s1c1
Sequence:CCGGGCCTATCATGGTCACCATCAACTCGAGTTGATGGTGACCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015199.1-2390s1c1
Sequence:CCGGGCATCACAGAAGGGCGTATTTCTCGAGAAATACGCCCTTCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-931s1c1
Sequence:CCGGGCTATCCATTGGGCAGCATATCTCGAGATATGCTGCCCAATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015199
VALIDATED
ANKRD28 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015199.1-467s1c1
Sequence:CCGGCTGATGAAGTTCGAGCACTAACTCGAGTTAGTGCTCGAACTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-1261s1c1
Sequence:CCGGGCATTGTGTTTAGAGCTTCTACTCGAGTAGAAGCTCTAAACACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-2077s1c1
Sequence:CCGGGCCTATCATGGTCACCATCAACTCGAGTTGATGGTGACCATGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015199.1-2390s1c1
Sequence:CCGGGCATCACAGAAGGGCGTATTTCTCGAGAAATACGCCCTTCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015199.1-931s1c1
Sequence:CCGGGCTATCCATTGGGCAGCATATCTCGAGATATGCTGCCCAATGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks