EMAIL THIS PAGE TO A FRIEND

ANKRD29

ankyrin repeat domain 29

172 Gene Product Result for
UniProtKB ID: Q8N6D5, B2R972, Q6ZWE8, Q96LU9
Gene ID:
Mouse(225187) ankyrin repeat domain 29
Rat(498823) ankyrin repeat domain 29
Zebrafish(553798) ankyrin repeat domain 29
cow(526872) ankyrin repeat domain 29
Horse(100059056) ankyrin repeat domain 29
domestic cat(101099663) ankyrin repeat domain 29
dog(606927) ankyrin repeat domain 29
chicken(428523) ankyrin repeat domain 29
domestic guinea pig(100717577) ankyrin repeat domain 29
naked mole-rat(101709395) ankyrin repeat domain 29
sheep(101120373) ankyrin repeat domain 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173505 Rosetta Predictions human pricing
XM_574104 Rosetta Predictions rat pricing
XM_001474217 Rosetta Predictions mouse pricing
XM_129028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368275 predicted 1412
2 SASI_Hs01_00113915 predicted 1443
3 SASI_Hs01_00113916 predicted 328
4 SASI_Hs01_00113917 predicted 375
5 SASI_Hs01_00113918 predicted 810
6 SASI_Hs01_00113919 predicted 1530
7 SASI_Hs01_00113920 predicted 385
8 SASI_Hs01_00113921 predicted 433
9 SASI_Hs01_00113922 predicted 459
10 SASI_Hs01_00113924 predicted 928
11 SASI_Hs01_00113923 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401390 predicted 995
2 SASI_Rn02_00401391 predicted 848
3 SASI_Rn02_00401392 predicted 1440
4 SASI_Rn02_00401393 predicted 926
5 SASI_Rn02_00401394 predicted 765
6 SASI_Rn02_00401395 predicted 952
7 SASI_Rn02_00401396 predicted 1114
8 SASI_Rn02_00401397 predicted 1422
9 SASI_Rn02_00401398 predicted 1035
10 SASI_Rn02_00401399 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00373833 predicted 343
2 SASI_Mm02_00373834 predicted 752
3 SASI_Mm02_00373835 predicted 727
4 SASI_Mm02_00373836 predicted 543
5 SASI_Mm02_00373837 predicted 348
6 SASI_Mm02_00373838 predicted 345
7 SASI_Mm02_00373839 predicted 737
8 SASI_Mm02_00373840 predicted 1068
9 SASI_Mm02_00373841 predicted 992
10 SASI_Mm02_00373842 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225444 predicted 348
2 SASI_Mm02_00424299 predicted 752
3 SASI_Mm01_00225445 predicted 728
4 SASI_Mm01_00225447 predicted 544
5 SASI_Mm01_00225448 predicted 353
6 SASI_Mm01_00225449 predicted 340
7 SASI_Mm01_00225450 predicted 735
8 SASI_Mm01_00225451 predicted 1066
9 SASI_Mm01_00225452 predicted 988
10 SASI_Mm01_00225453 predicted 481
11 SASI_Mm01_00225446 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173505
VALIDATED
ANKRD29 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 29
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173505.1-1863s1c1
Sequence:CCGGGCTCTATTGTTGGGAATCTATCTCGAGATAGATTCCCAACAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-429s1c1
Sequence:CCGGGCCATAATGATGTCGTGAGATCTCGAGATCTCACGACATCATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-391s1c1
Sequence:CCGGGTCAGGTACAACTGCCCTATTCTCGAGAATAGGGCAGTTGTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-820s1c1
Sequence:CCGGCAAAGGGTATAATGATGTCATCTCGAGATGACATCATTATACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-968s1c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-783s21c1
Sequence:CCGGACGATGGCACAACAGCATTATCTCGAGATAATGCTGTTGTGCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-965s21c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173505.2-1535s21c1
Sequence:CCGGTGTATGTCATTCCAGTATAAACTCGAGTTTATACTGGAATGACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-626s21c1
Sequence:CCGGTACTTGGATGTTATTCGATTACTCGAGTAATCGAATAACATCCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-1058s21c1
Sequence:CCGGAGCTAACTTAGCTCCATATTTCTCGAGAAATATGGAGCTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173505
VALIDATED
ANKRD29 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 29
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173505.1-1863s1c1
Sequence:CCGGGCTCTATTGTTGGGAATCTATCTCGAGATAGATTCCCAACAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-429s1c1
Sequence:CCGGGCCATAATGATGTCGTGAGATCTCGAGATCTCACGACATCATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-391s1c1
Sequence:CCGGGTCAGGTACAACTGCCCTATTCTCGAGAATAGGGCAGTTGTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-820s1c1
Sequence:CCGGCAAAGGGTATAATGATGTCATCTCGAGATGACATCATTATACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-968s1c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-783s21c1
Sequence:CCGGACGATGGCACAACAGCATTATCTCGAGATAATGCTGTTGTGCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-965s21c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173505.2-1535s21c1
Sequence:CCGGTGTATGTCATTCCAGTATAAACTCGAGTTTATACTGGAATGACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-626s21c1
Sequence:CCGGTACTTGGATGTTATTCGATTACTCGAGTAATCGAATAACATCCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-1058s21c1
Sequence:CCGGAGCTAACTTAGCTCCATATTTCTCGAGAAATATGGAGCTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173505
VALIDATED
ANKRD29 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 29
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173505.1-1863s1c1
Sequence:CCGGGCTCTATTGTTGGGAATCTATCTCGAGATAGATTCCCAACAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-429s1c1
Sequence:CCGGGCCATAATGATGTCGTGAGATCTCGAGATCTCACGACATCATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-391s1c1
Sequence:CCGGGTCAGGTACAACTGCCCTATTCTCGAGAATAGGGCAGTTGTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-820s1c1
Sequence:CCGGCAAAGGGTATAATGATGTCATCTCGAGATGACATCATTATACCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173505.1-968s1c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-783s21c1
Sequence:CCGGACGATGGCACAACAGCATTATCTCGAGATAATGCTGTTGTGCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-965s21c1
Sequence:CCGGTCCCTGAGAAACAAGGCCAATCTCGAGATTGGCCTTGTTTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173505.2-1535s21c1
Sequence:CCGGTGTATGTCATTCCAGTATAAACTCGAGTTTATACTGGAATGACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-626s21c1
Sequence:CCGGTACTTGGATGTTATTCGATTACTCGAGTAATCGAATAACATCCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_173505.2-1058s21c1
Sequence:CCGGAGCTAACTTAGCTCCATATTTCTCGAGAAATATGGAGCTAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks