EMAIL THIS PAGE TO A FRIEND

ANKRD2

ankyrin repeat domain 2 (stretch responsive muscle)

48 Gene Product Result for
Synonyms: ARPP
Gene ID:
Human(26287) Summary: ANKRD2 belongs to the conserved muscle ankyrin repeat protein (MARP) family. Expression of MARPs is induced in response to physiologic stress, injury, and hypertrophy (Miller et al., 2003 [PubMed 14583192]
Mouse(56642) ankyrin repeat domain 2 (stretch responsive muscle)
Rat(309374) ankyrin repeat domain 2 (stretch responsive muscle)
chicken(423841) ankyrin repeat domain 2 (stretch responsive muscle)
cow(100847218) ankyrin repeat domain 2 (stretch responsive muscle)
domestic cat(101101168) ankyrin repeat domain 2 (stretch responsive muscle)
dog(486822) ankyrin repeat domain 2 (stretch responsive muscle)
sheep(101109057) ankyrin repeat domain 2 (stretch responsive muscle)
naked mole-rat(101698795) ankyrin repeat domain 2 (stretch responsive muscle)
domestic guinea pig(100716042) ankyrin repeat domain 2 (stretch responsive muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074651 MISSION® esiRNA esiRNA human ANKRD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020349 Rosetta Predictions human pricing
NM_001107589 Rosetta Predictions rat pricing
NM_020033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217676 predicted 874
2 SASI_Hs01_00217677 predicted 1122
3 SASI_Hs01_00217678 predicted 915
4 SASI_Hs01_00217679 predicted 480
5 SASI_Hs01_00217680 predicted 543
6 SASI_Hs01_00217681 predicted 986
7 SASI_Hs01_00217682 predicted 846
8 SASI_Hs01_00217683 predicted 1068
9 SASI_Hs02_00353285 predicted 819
10 SASI_Hs01_00217685 predicted 799
11 SASI_Hs01_00217684 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230325 predicted 214
2 SASI_Rn02_00230326 predicted 660
3 SASI_Rn02_00230327 predicted 349
4 SASI_Rn02_00230328 predicted 826
5 SASI_Rn02_00230329 predicted 626
6 SASI_Rn02_00230330 predicted 694
7 SASI_Rn02_00230331 predicted 761
8 SASI_Rn02_00230332 predicted 770
9 SASI_Rn02_00230333 predicted 332
10 SASI_Rn02_00230334 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325399 predicted 724
2 SASI_Mm01_00135634 predicted 254
3 SASI_Mm01_00135635 predicted 339
4 SASI_Mm01_00135636 predicted 765
5 SASI_Mm01_00135637 predicted 660
6 SASI_Mm01_00135638 predicted 486
7 SASI_Mm01_00135639 predicted 694
8 SASI_Mm01_00135640 predicted 827
9 SASI_Mm02_00325400 predicted 771
10 SASI_Mm01_00135642 predicted 221
11 SASI_Mm01_00135633 predicted 845
12 SASI_Mm01_00135641 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020349
ANKRD2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 2 (stretch responsive muscle)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1019s1c1
Sequence:CCGGCCTGGAAATCAATGCCAGAGACTCGAGTCTCTGGCATTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-369s1c1
Sequence:CCGGGAGAATGAGAAACTCCGAGGACTCGAGTCCTCGGAGTTTCTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-990s1c1
Sequence:CCGGGAGATTGTGGAGCACTTTCTACTCGAGTAGAAAGTGCTCCACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-797s1c1
Sequence:CCGGCCTGGAGAAGCTTCTAGATAACTCGAGTTATCTAGAAGCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-360s1c1
Sequence:CCGGCAGGAGGAGGAGAATGAGAAACTCGAGTTTCTCATTCTCCTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-891s1c1
Sequence:CCGGGAGGTGGTGAAACTTCTGCAACTCGAGTTGCAGAAGTTTCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1119s1c1
Sequence:CCGGGCTGACATGATGACCAAGAACCTCGAGGTTCTTGGTCATCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-651s1c1
Sequence:CCGGGATGAGGAGACCTTCCTGAAACTCGAGTTTCAGGAAGGTCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1246s1c1
Sequence:CCGGCTAATGATAGTGGGCGAGAGACTCGAGTCTCTCGCCCACTATCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-785s1c1
Sequence:CCGGCCACATGGAAATCCTGGAGAACTCGAGTTCTCCAGGATTTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-922s1c1
Sequence:CCGGCAGACACCAATGTGAGGGATACTCGAGTATCCCTCACATTGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020349
ANKRD2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 2 (stretch responsive muscle)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1019s1c1
Sequence:CCGGCCTGGAAATCAATGCCAGAGACTCGAGTCTCTGGCATTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-369s1c1
Sequence:CCGGGAGAATGAGAAACTCCGAGGACTCGAGTCCTCGGAGTTTCTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-990s1c1
Sequence:CCGGGAGATTGTGGAGCACTTTCTACTCGAGTAGAAAGTGCTCCACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-797s1c1
Sequence:CCGGCCTGGAGAAGCTTCTAGATAACTCGAGTTATCTAGAAGCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-360s1c1
Sequence:CCGGCAGGAGGAGGAGAATGAGAAACTCGAGTTTCTCATTCTCCTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-891s1c1
Sequence:CCGGGAGGTGGTGAAACTTCTGCAACTCGAGTTGCAGAAGTTTCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1119s1c1
Sequence:CCGGGCTGACATGATGACCAAGAACCTCGAGGTTCTTGGTCATCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-651s1c1
Sequence:CCGGGATGAGGAGACCTTCCTGAAACTCGAGTTTCAGGAAGGTCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1246s1c1
Sequence:CCGGCTAATGATAGTGGGCGAGAGACTCGAGTCTCTCGCCCACTATCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-785s1c1
Sequence:CCGGCCACATGGAAATCCTGGAGAACTCGAGTTCTCCAGGATTTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-922s1c1
Sequence:CCGGCAGACACCAATGTGAGGGATACTCGAGTATCCCTCACATTGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020349
ANKRD2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 2 (stretch responsive muscle)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1019s1c1
Sequence:CCGGCCTGGAAATCAATGCCAGAGACTCGAGTCTCTGGCATTGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-369s1c1
Sequence:CCGGGAGAATGAGAAACTCCGAGGACTCGAGTCCTCGGAGTTTCTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-990s1c1
Sequence:CCGGGAGATTGTGGAGCACTTTCTACTCGAGTAGAAAGTGCTCCACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-797s1c1
Sequence:CCGGCCTGGAGAAGCTTCTAGATAACTCGAGTTATCTAGAAGCTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-360s1c1
Sequence:CCGGCAGGAGGAGGAGAATGAGAAACTCGAGTTTCTCATTCTCCTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-891s1c1
Sequence:CCGGGAGGTGGTGAAACTTCTGCAACTCGAGTTGCAGAAGTTTCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1119s1c1
Sequence:CCGGGCTGACATGATGACCAAGAACCTCGAGGTTCTTGGTCATCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-651s1c1
Sequence:CCGGGATGAGGAGACCTTCCTGAAACTCGAGTTTCAGGAAGGTCTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-1246s1c1
Sequence:CCGGCTAATGATAGTGGGCGAGAGACTCGAGTCTCTCGCCCACTATCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-785s1c1
Sequence:CCGGCCACATGGAAATCCTGGAGAACTCGAGTTCTCCAGGATTTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020349.2-922s1c1
Sequence:CCGGCAGACACCAATGTGAGGGATACTCGAGTATCCCTCACATTGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020033
ANKRD2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 2 (stretch responsive muscle)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-779s1c1
Sequence:CCGGGTGAGACTCAACCGCTACAAACTCGAGTTTGTAGCGGTTGAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-919s1c1
Sequence:CCGGCGAGCCAGAATCAGAGCAGAACTCGAGTTCTGCTCTGATTCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-227s1c1
Sequence:CCGGCGTGAGATCATTGATGTGGGTCTCGAGACCCACATCAATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-693s1c1
Sequence:CCGGACGTGGAGATTGTGGAACATTCTCGAGAATGTTCCACAATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-122s1c1
Sequence:CCGGGACATGCTAGTGCTAGAGGAACTCGAGTTCCTCTAGCACTAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-716s21c1
Sequence:CCGGCTTTCCCTGGGCTTGGATATCCTCGAGGATATCCAAGCCCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-436s21c1
Sequence:CCGGAGCGGACACCTGTGATGAGTTCTCGAGAACTCATCACAGGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-826s21c1
Sequence:CCGGGGCGGACATGATGGCTAAGAACTCGAGTTCTTAGCCATCATGTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-78s21c1
Sequence:CCGGAGACTGAGAAACTTCGAAGATCTCGAGATCTTCGAAGTTTCTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020033
ANKRD2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 2 (stretch responsive muscle)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-779s1c1
Sequence:CCGGGTGAGACTCAACCGCTACAAACTCGAGTTTGTAGCGGTTGAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-919s1c1
Sequence:CCGGCGAGCCAGAATCAGAGCAGAACTCGAGTTCTGCTCTGATTCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-227s1c1
Sequence:CCGGCGTGAGATCATTGATGTGGGTCTCGAGACCCACATCAATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-693s1c1
Sequence:CCGGACGTGGAGATTGTGGAACATTCTCGAGAATGTTCCACAATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-122s1c1
Sequence:CCGGGACATGCTAGTGCTAGAGGAACTCGAGTTCCTCTAGCACTAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-716s21c1
Sequence:CCGGCTTTCCCTGGGCTTGGATATCCTCGAGGATATCCAAGCCCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-436s21c1
Sequence:CCGGAGCGGACACCTGTGATGAGTTCTCGAGAACTCATCACAGGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-826s21c1
Sequence:CCGGGGCGGACATGATGGCTAAGAACTCGAGTTCTTAGCCATCATGTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-78s21c1
Sequence:CCGGAGACTGAGAAACTTCGAAGATCTCGAGATCTTCGAAGTTTCTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020033
ANKRD2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 2 (stretch responsive muscle)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-779s1c1
Sequence:CCGGGTGAGACTCAACCGCTACAAACTCGAGTTTGTAGCGGTTGAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-919s1c1
Sequence:CCGGCGAGCCAGAATCAGAGCAGAACTCGAGTTCTGCTCTGATTCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-227s1c1
Sequence:CCGGCGTGAGATCATTGATGTGGGTCTCGAGACCCACATCAATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-693s1c1
Sequence:CCGGACGTGGAGATTGTGGAACATTCTCGAGAATGTTCCACAATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020033.1-122s1c1
Sequence:CCGGGACATGCTAGTGCTAGAGGAACTCGAGTTCCTCTAGCACTAGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-716s21c1
Sequence:CCGGCTTTCCCTGGGCTTGGATATCCTCGAGGATATCCAAGCCCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-436s21c1
Sequence:CCGGAGCGGACACCTGTGATGAGTTCTCGAGAACTCATCACAGGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-826s21c1
Sequence:CCGGGGCGGACATGATGGCTAAGAACTCGAGTTCTTAGCCATCATGTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020033.1-78s21c1
Sequence:CCGGAGACTGAGAAACTTCGAAGATCTCGAGATCTTCGAAGTTTCTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks