EMAIL THIS PAGE TO A FRIEND

ANKRD30A

ankyrin repeat domain 30A

43 Gene Product Result for
Synonyms: NY-BR-1
Species: Human ANKRD30A(91074)
UniProtKB ID: Q9BXX3, Q5W025
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052997 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177797 predicted 1106
2 SASI_Hs02_00361814 predicted 1366
3 SASI_Hs02_00361815 predicted 1087
4 SASI_Hs01_00177800 predicted 624
5 SASI_Hs02_00361816 predicted 1930
6 SASI_Hs02_00361817 predicted 1003
7 SASI_Hs01_00177802 predicted 636
8 SASI_Hs02_00361818 predicted 557
9 SASI_Hs01_00177805 predicted 308
10 SASI_Hs01_00177798 predicted 3362
11 SASI_Hs01_00177799 predicted 3872
12 SASI_Hs01_00177801 predicted 3605
13 SASI_Hs01_00177803 predicted 3682
14 SASI_Hs01_00177804 predicted 3889
15 SASI_Hs01_00177806 predicted 3979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052997
ANKRD30A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 30A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-682s21c1
Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-620s21c1
Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1765s21c1
Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-281s21c1
Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-308s21c1
Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052997.2-4199s21c1
Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1098s21c1
Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-3384s21c1
Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-1763s1c1
Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-2121s1c1
Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-628s1c1
Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052997
ANKRD30A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 30A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-682s21c1
Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-620s21c1
Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1765s21c1
Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-281s21c1
Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-308s21c1
Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052997.2-4199s21c1
Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1098s21c1
Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-3384s21c1
Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-1763s1c1
Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-2121s1c1
Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-628s1c1
Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052997
ANKRD30A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 30A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-682s21c1
Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-620s21c1
Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1765s21c1
Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-281s21c1
Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-308s21c1
Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052997.2-4199s21c1
Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-1098s21c1
Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052997.2-3384s21c1
Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-1763s1c1
Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-2121s1c1
Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052997.1-628s1c1
Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks