EMAIL THIS PAGE TO A FRIEND

ANKRD30B

ankyrin repeat domain 30B

45 Gene Product Result for
Synonyms: NY-BR-1.1
Species: Human ANKRD30B(374860)
UniProtKB ID: Q9BXX2, B4DGP1, F8WAG3, Q4G175
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029862 Rosetta Predictions human pricing
XM_001716904 Rosetta Predictions human pricing
XM_001717561 Rosetta Predictions human pricing
XM_001717810 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033892 predicted 1856
2 SASI_Hs01_00033893 predicted 682
3 SASI_Hs01_00033894 predicted 833
4 SASI_Hs01_00033895 predicted 262
5 SASI_Hs01_00033896 predicted 1412
6 SASI_Hs01_00033897 predicted 1423
7 SASI_Hs01_00033898 predicted 1439
8 SASI_Hs01_00033899 predicted 1445
9 SASI_Hs01_00033900 predicted 1399
10 SASI_Hs01_00033901 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413726 predicted 2377
2 SASI_Hs02_00413727 predicted 358
3 SASI_Hs02_00413728 predicted 4160
4 SASI_Hs02_00413729 predicted 3961
5 SASI_Hs02_00413730 predicted 2821
6 SASI_Hs02_00413731 predicted 2825
7 SASI_Hs02_00413732 predicted 3619
8 SASI_Hs02_00413733 predicted 2237
9 SASI_Hs02_00413734 predicted 1511
10 SASI_Hs02_00413735 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417980 predicted 771
2 SASI_Hs02_00417981 predicted 351
3 SASI_Hs02_00417982 predicted 1512
4 SASI_Hs02_00417983 predicted 1521
5 SASI_Hs02_00417984 predicted 1532
6 SASI_Hs02_00417985 predicted 890
7 SASI_Hs02_00417986 predicted 412
8 SASI_Hs02_00417987 predicted 1500
9 SASI_Hs02_00417988 predicted 457
10 SASI_Hs02_00417989 predicted 2380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419653 predicted 2705
2 SASI_Hs02_00419654 predicted 1846
3 SASI_Hs02_00419655 predicted 681
4 SASI_Hs02_00419656 predicted 2750
5 SASI_Hs02_00419657 predicted 2286
6 SASI_Hs02_00419658 predicted 254
7 SASI_Hs02_00419659 predicted 2168
8 SASI_Hs02_00419660 predicted 2448
9 SASI_Hs02_00419661 predicted 2726
10 SASI_Hs02_00419662 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029862
ANKRD30B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 30B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029862.1-2190s1c1
Sequence:CCGGGCTCAGATGTTCCCATCAGAACTCGAGTTCTGATGGGAACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-1449s1c1
Sequence:CCGGCGTGTTTACCTGATGCTACATCTCGAGATGTAGCATCAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-2040s1c1
Sequence:CCGGCTTCCAAATAAAGCCTTAGAACTCGAGTTCTAAGGCTTTATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-3173s1c1
Sequence:CCGGGAAACCATCATTCTCAGCAAACTCGAGTTTGCTGAGAATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1328s1c1
Sequence:CCGGGTAGAGCCTATATTCAGTCTTCTCGAGAAGACTGAATATAGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-674s1c1
Sequence:CCGGGCAAATGCAAACGCATTTAATCTCGAGATTAAATGCGTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1399s1c1
Sequence:CCGGCCTTAATCTTGCTACCAAGATCTCGAGATCTTGGTAGCAAGATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-339s1c1
Sequence:CCGGGCCATGCAGAAGTAGTAACATCTCGAGATGTTACTACTTCTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029862
ANKRD30B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 30B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029862.1-2190s1c1
Sequence:CCGGGCTCAGATGTTCCCATCAGAACTCGAGTTCTGATGGGAACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-1449s1c1
Sequence:CCGGCGTGTTTACCTGATGCTACATCTCGAGATGTAGCATCAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-2040s1c1
Sequence:CCGGCTTCCAAATAAAGCCTTAGAACTCGAGTTCTAAGGCTTTATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-3173s1c1
Sequence:CCGGGAAACCATCATTCTCAGCAAACTCGAGTTTGCTGAGAATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1328s1c1
Sequence:CCGGGTAGAGCCTATATTCAGTCTTCTCGAGAAGACTGAATATAGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-674s1c1
Sequence:CCGGGCAAATGCAAACGCATTTAATCTCGAGATTAAATGCGTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1399s1c1
Sequence:CCGGCCTTAATCTTGCTACCAAGATCTCGAGATCTTGGTAGCAAGATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-339s1c1
Sequence:CCGGGCCATGCAGAAGTAGTAACATCTCGAGATGTTACTACTTCTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029862
ANKRD30B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 30B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029862.1-2190s1c1
Sequence:CCGGGCTCAGATGTTCCCATCAGAACTCGAGTTCTGATGGGAACATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-1449s1c1
Sequence:CCGGCGTGTTTACCTGATGCTACATCTCGAGATGTAGCATCAGGTAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-2040s1c1
Sequence:CCGGCTTCCAAATAAAGCCTTAGAACTCGAGTTCTAAGGCTTTATTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029862.1-3173s1c1
Sequence:CCGGGAAACCATCATTCTCAGCAAACTCGAGTTTGCTGAGAATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1328s1c1
Sequence:CCGGGTAGAGCCTATATTCAGTCTTCTCGAGAAGACTGAATATAGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-674s1c1
Sequence:CCGGGCAAATGCAAACGCATTTAATCTCGAGATTAAATGCGTTTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029862.1-1399s1c1
Sequence:CCGGCCTTAATCTTGCTACCAAGATCTCGAGATCTTGGTAGCAAGATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029862.1-339s1c1
Sequence:CCGGGCCATGCAGAAGTAGTAACATCTCGAGATGTTACTACTTCTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks