EMAIL THIS PAGE TO A FRIEND

ANKRD30BL

ankyrin repeat domain 30B-like

29 Gene Product Result for
Synonyms: ANKRD30BP3 NCRNA00164
Species: Human ANKRD30BL(554226)
UniProtKB ID: A7E2S9, B8ZZL7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024655 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017732 Rosetta Predictions human pricing
XR_040111 Rosetta Predictions human pricing
XR_042131 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494212 predicted 861
2 SASI_Hs02_00494213 predicted 339
3 SASI_Hs02_00494214 predicted 845
4 SASI_Hs02_00494215 predicted 568
5 SASI_Hs02_00494216 predicted 682
6 SASI_Hs02_00494217 predicted 679
7 SASI_Hs02_00494218 predicted 669
8 SASI_Hs02_00494219 predicted 659
9 SASI_Hs02_00494220 predicted 367
10 SASI_Hs02_00494221 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515969 predicted 856
2 SASI_Hs02_00515970 predicted 336
3 SASI_Hs02_00515971 predicted 839
4 SASI_Hs02_00515972 predicted 566
5 SASI_Hs02_00515973 predicted 683
6 SASI_Hs02_00515974 predicted 687
7 SASI_Hs02_00515975 predicted 674
8 SASI_Hs02_00515976 predicted 660
9 SASI_Hs02_00515977 predicted 363
10 SASI_Hs02_00515978 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533341 predicted 338
2 SASI_Hs02_00533342 predicted 566
3 SASI_Hs02_00533343 predicted 366
4 SASI_Hs02_00533344 predicted 738
5 SASI_Hs02_00533345 predicted 955
6 SASI_Hs02_00533346 predicted 957
7 SASI_Hs02_00533347 predicted 935
8 SASI_Hs02_00533348 predicted 1011
9 SASI_Hs02_00533349 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024655
ANKRD30BL MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 30B-like
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000183329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024655.1-839s1c1
Sequence:CCGGGCAAATGCAGTTGATAAGTTTCTCGAGAAACTTATCAACTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024655
ANKRD30BL MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 30B-like
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000183329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024655.1-839s1c1
Sequence:CCGGGCAAATGCAGTTGATAAGTTTCTCGAGAAACTTATCAACTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024655
ANKRD30BL MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 30B-like
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000183329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024655.1-839s1c1
Sequence:CCGGGCAAATGCAGTTGATAAGTTTCTCGAGAAACTTATCAACTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks