EMAIL THIS PAGE TO A FRIEND

ANKRD30BP2

ankyrin repeat domain 30B pseudogene 2

45 Gene Product Result for
Synonyms: C21orf99 CT85 CTSP-1 CTSP1
Species: Human ANKRD30BP2(149992)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040882 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522797 predicted 593
2 SASI_Hs02_00522798 predicted 474
3 SASI_Hs02_00522799 predicted 466
4 SASI_Hs02_00522800 predicted 483
5 SASI_Hs02_00522801 predicted 429
6 SASI_Hs02_00522802 predicted 589
7 SASI_Hs02_00522803 predicted 422
8 SASI_Hs02_00522804 predicted 413
9 SASI_Hs02_00522805 predicted 408
10 SASI_Hs02_00522806 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153773
ANKRD30BP2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 30B pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-339s1c1
Sequence:CCGGCCAGAAGGAACATCTGAAGGACTCGAGTCCTTCAGATGTTCCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-342s1c1
Sequence:CCGGGAAGGAACATCTGAAGGAACACTCGAGTGTTCCTTCAGATGTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-424s1c1
Sequence:CCGGGAACACCTGACGAATAGGATACTCGAGTATCCTATTCGTCAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-406s1c1
Sequence:CCGGCTGAAAGCTTGGTGGAAAGAACTCGAGTTCTTTCCACCAAGCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-340s1c1
Sequence:CCGGCAGAAGGAACATCTGAAGGAACTCGAGTTCCTTCAGATGTTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153773
ANKRD30BP2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 30B pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-339s1c1
Sequence:CCGGCCAGAAGGAACATCTGAAGGACTCGAGTCCTTCAGATGTTCCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-342s1c1
Sequence:CCGGGAAGGAACATCTGAAGGAACACTCGAGTGTTCCTTCAGATGTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-424s1c1
Sequence:CCGGGAACACCTGACGAATAGGATACTCGAGTATCCTATTCGTCAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-406s1c1
Sequence:CCGGCTGAAAGCTTGGTGGAAAGAACTCGAGTTCTTTCCACCAAGCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-340s1c1
Sequence:CCGGCAGAAGGAACATCTGAAGGAACTCGAGTTCCTTCAGATGTTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153773
ANKRD30BP2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 30B pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-339s1c1
Sequence:CCGGCCAGAAGGAACATCTGAAGGACTCGAGTCCTTCAGATGTTCCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-342s1c1
Sequence:CCGGGAAGGAACATCTGAAGGAACACTCGAGTGTTCCTTCAGATGTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-424s1c1
Sequence:CCGGGAACACCTGACGAATAGGATACTCGAGTATCCTATTCGTCAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-406s1c1
Sequence:CCGGCTGAAAGCTTGGTGGAAAGAACTCGAGTTCTTTCCACCAAGCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153773.1-340s1c1
Sequence:CCGGCAGAAGGAACATCTGAAGGAACTCGAGTTCCTTCAGATGTTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)