EMAIL THIS PAGE TO A FRIEND

ANKRD32

ankyrin repeat domain 32

58 Gene Product Result for
Synonyms: BRCTD1 BRCTx
UniProtKB ID: Q9BQI6, Q3B7K4, Q6NSA5, Q6PHW9, Q9Y402
Gene ID:
Mouse(105377) ankyrin repeat domain 32
Rat(294601) ankyrin repeat domain 32
domestic guinea pig(100721480) ankyrin repeat domain 32
naked mole-rat(101726345) ankyrin repeat domain 32
sheep(101108386) ankyrin repeat domain 32
chicken(427111) ankyrin repeat domain 32
cow(520250) ankyrin repeat domain 32
Horse(100073233) ankyrin repeat domain 32
domestic cat(101080865) ankyrin repeat domain 32
dog(488907) ankyrin repeat domain 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032290 Rosetta Predictions human pricing
NM_001106400 Rosetta Predictions rat pricing
NM_134071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359611 predicted 1237
2 SASI_Hs01_00232617 predicted 2510
3 SASI_Hs01_00232618 predicted 3131
4 SASI_Hs02_00359612 predicted 1377
5 SASI_Hs02_00359613 predicted 275
6 SASI_Hs01_00232621 predicted 3092
7 SASI_Hs02_00359614 predicted 1973
8 SASI_Hs02_00359615 predicted 1204
9 SASI_Hs02_00359616 predicted 697
10 SASI_Hs02_00359617 predicted 1532
11 SASI_Hs01_00232619 predicted 986
12 SASI_Hs01_00232620 predicted 282
13 SASI_Hs01_00232622 predicted 1308
14 SASI_Hs01_00232623 predicted 1293
15 SASI_Hs01_00232624 predicted 415
16 SASI_Hs01_00232625 predicted 453
17 SASI_Hs01_00232626 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218588 predicted 1272
2 SASI_Rn02_00218589 predicted 599
3 SASI_Rn02_00218590 predicted 1085
4 SASI_Rn02_00218591 predicted 316
5 SASI_Rn02_00218592 predicted 2891
6 SASI_Rn02_00218593 predicted 2053
7 SASI_Rn02_00218594 predicted 3271
8 SASI_Rn02_00218595 predicted 1139
9 SASI_Rn02_00218596 predicted 2648
10 SASI_Rn02_00218597 predicted 3051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339258 predicted 1264
2 SASI_Mm01_00161134 predicted 2669
3 SASI_Mm02_00339259 predicted 1687
4 SASI_Mm02_00339260 predicted 608
5 SASI_Mm01_00161137 predicted 2642
6 SASI_Mm01_00161138 predicted 2881
7 SASI_Mm02_00339261 predicted 1301
8 SASI_Mm01_00161139 predicted 2038
9 SASI_Mm02_00339262 predicted 677
10 SASI_Mm02_00339263 predicted 492
11 SASI_Mm01_00161132 predicted 1062
12 SASI_Mm01_00161133 predicted 1908
13 SASI_Mm01_00161135 predicted 1020
14 SASI_Mm01_00161136 predicted 1812
15 SASI_Mm01_00161140 predicted 1175
16 SASI_Mm01_00161141 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032290
VALIDATED
ANKRD32 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 32
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-641s1c1
Sequence:CCGGGCCTTTGCATGAAGCCTGTAACTCGAGTTACAGGCTTCATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-47s1c1
Sequence:CCGGGTCTGATGACTTAGGAAGTTACTCGAGTAACTTCCTAAGTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-140s1c1
Sequence:CCGGGCTTCAAATGTTTGTTGCAGACTCGAGTCTGCAACAAACATTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-390s1c1
Sequence:CCGGGAGTTACTAGACCTGAACCTTCTCGAGAAGGTTCAGGTCTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-962s1c1
Sequence:CCGGGCAACTTGAATTTGGCTCCTTCTCGAGAAGGAGCCAAATTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1302s21c2
Sequence:GTACCGGGAATTTCCCAGAGGTGTATTACTCGAGTAATACACCTCTGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032290.3-3295s21c2
Sequence:GTACCGGTCAGTTTGCATTGGTACTTACCTCGAGGTAAGTACCAATGCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1526s21c2
Sequence:CCGGTCCAGCCATGTCGAGATATTACTCGAGTAATATCTCGACATGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-279s21c2
Sequence:CCGGATACTAACCAAGGACTATATACTCGAGTATATAGTCCTTGGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1948s21c2
Sequence:CCGGTTGGAGCAGCAATAGATTATTCTCGAGAATAATCTATTGCTGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032290
VALIDATED
ANKRD32 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 32
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-641s1c1
Sequence:CCGGGCCTTTGCATGAAGCCTGTAACTCGAGTTACAGGCTTCATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-47s1c1
Sequence:CCGGGTCTGATGACTTAGGAAGTTACTCGAGTAACTTCCTAAGTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-140s1c1
Sequence:CCGGGCTTCAAATGTTTGTTGCAGACTCGAGTCTGCAACAAACATTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-390s1c1
Sequence:CCGGGAGTTACTAGACCTGAACCTTCTCGAGAAGGTTCAGGTCTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-962s1c1
Sequence:CCGGGCAACTTGAATTTGGCTCCTTCTCGAGAAGGAGCCAAATTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1302s21c2
Sequence:GTACCGGGAATTTCCCAGAGGTGTATTACTCGAGTAATACACCTCTGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032290.3-3295s21c2
Sequence:GTACCGGTCAGTTTGCATTGGTACTTACCTCGAGGTAAGTACCAATGCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1526s21c2
Sequence:CCGGTCCAGCCATGTCGAGATATTACTCGAGTAATATCTCGACATGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-279s21c2
Sequence:CCGGATACTAACCAAGGACTATATACTCGAGTATATAGTCCTTGGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1948s21c2
Sequence:CCGGTTGGAGCAGCAATAGATTATTCTCGAGAATAATCTATTGCTGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032290
VALIDATED
ANKRD32 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 32
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-641s1c1
Sequence:CCGGGCCTTTGCATGAAGCCTGTAACTCGAGTTACAGGCTTCATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-47s1c1
Sequence:CCGGGTCTGATGACTTAGGAAGTTACTCGAGTAACTTCCTAAGTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032290.1-140s1c1
Sequence:CCGGGCTTCAAATGTTTGTTGCAGACTCGAGTCTGCAACAAACATTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-390s1c1
Sequence:CCGGGAGTTACTAGACCTGAACCTTCTCGAGAAGGTTCAGGTCTAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032290.1-962s1c1
Sequence:CCGGGCAACTTGAATTTGGCTCCTTCTCGAGAAGGAGCCAAATTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1302s21c2
Sequence:GTACCGGGAATTTCCCAGAGGTGTATTACTCGAGTAATACACCTCTGGGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032290.3-3295s21c2
Sequence:GTACCGGTCAGTTTGCATTGGTACTTACCTCGAGGTAAGTACCAATGCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1526s21c2
Sequence:CCGGTCCAGCCATGTCGAGATATTACTCGAGTAATATCTCGACATGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-279s21c2
Sequence:CCGGATACTAACCAAGGACTATATACTCGAGTATATAGTCCTTGGTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032290.3-1948s21c2
Sequence:CCGGTTGGAGCAGCAATAGATTATTCTCGAGAATAATCTATTGCTGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134071
VALIDATED
ANKRD32 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 32
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-1307s1c1
Sequence:CCGGCCTCAGAATTTATCCTAGCTTCTCGAGAAGCTAGGATAAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-675s1c1
Sequence:CCGGCCTAGAGTTAAACCGTGCTAACTCGAGTTAGCACGGTTTAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134071.1-749s1c1
Sequence:CCGGCCAAGGAGAATTGCCCATCTTCTCGAGAAGATGGGCAATTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-864s1c1
Sequence:CCGGCCTTCTGTCTTTGCCAGGAATCTCGAGATTCCTGGCAAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3300s21c1
Sequence:CCGGAGATGTCTGAACGTGCAACATCTCGAGATGTTGCACGTTCAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-1068s21c1
Sequence:CCGGGATGATGCCCATGATACAATTCTCGAGAATTGTATCATGGGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-3108s21c1
Sequence:CCGGGCACATACTGACTGGTTATTGCTCGAGCAATAACCAGTCAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-2979s21c1
Sequence:CCGGCTTAGTAGGATGTTGATTAATCTCGAGATTAATCAACATCCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3331s21c1
Sequence:CCGGTTAGTATATCCATAGCTTATGCTCGAGCATAAGCTATGGATATACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134071
VALIDATED
ANKRD32 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 32
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-1307s1c1
Sequence:CCGGCCTCAGAATTTATCCTAGCTTCTCGAGAAGCTAGGATAAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-675s1c1
Sequence:CCGGCCTAGAGTTAAACCGTGCTAACTCGAGTTAGCACGGTTTAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134071.1-749s1c1
Sequence:CCGGCCAAGGAGAATTGCCCATCTTCTCGAGAAGATGGGCAATTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-864s1c1
Sequence:CCGGCCTTCTGTCTTTGCCAGGAATCTCGAGATTCCTGGCAAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3300s21c1
Sequence:CCGGAGATGTCTGAACGTGCAACATCTCGAGATGTTGCACGTTCAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-1068s21c1
Sequence:CCGGGATGATGCCCATGATACAATTCTCGAGAATTGTATCATGGGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-3108s21c1
Sequence:CCGGGCACATACTGACTGGTTATTGCTCGAGCAATAACCAGTCAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-2979s21c1
Sequence:CCGGCTTAGTAGGATGTTGATTAATCTCGAGATTAATCAACATCCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3331s21c1
Sequence:CCGGTTAGTATATCCATAGCTTATGCTCGAGCATAAGCTATGGATATACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134071
VALIDATED
ANKRD32 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 32
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-1307s1c1
Sequence:CCGGCCTCAGAATTTATCCTAGCTTCTCGAGAAGCTAGGATAAATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-675s1c1
Sequence:CCGGCCTAGAGTTAAACCGTGCTAACTCGAGTTAGCACGGTTTAACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134071.1-749s1c1
Sequence:CCGGCCAAGGAGAATTGCCCATCTTCTCGAGAAGATGGGCAATTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134071.1-864s1c1
Sequence:CCGGCCTTCTGTCTTTGCCAGGAATCTCGAGATTCCTGGCAAAGACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3300s21c1
Sequence:CCGGAGATGTCTGAACGTGCAACATCTCGAGATGTTGCACGTTCAGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-1068s21c1
Sequence:CCGGGATGATGCCCATGATACAATTCTCGAGAATTGTATCATGGGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-3108s21c1
Sequence:CCGGGCACATACTGACTGGTTATTGCTCGAGCAATAACCAGTCAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134071.3-2979s21c1
Sequence:CCGGCTTAGTAGGATGTTGATTAATCTCGAGATTAATCAACATCCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134071.3-3331s21c1
Sequence:CCGGTTAGTATATCCATAGCTTATGCTCGAGCATAAGCTATGGATATACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks