EMAIL THIS PAGE TO A FRIEND

ANKRD33

ankyrin repeat domain 33

79 Gene Product Result for
Synonyms: C12orf7 PANKY
Gene ID:
Mouse(208258) ankyrin repeat domain 33
chicken(430112) ankyrin repeat domain 33
domestic guinea pig(100733722) ankyrin repeat domain 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182608 Rosetta Predictions human pricing
NM_144790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146436 predicted 977
2 SASI_Hs01_00146437 predicted 327
3 SASI_Hs01_00146438 predicted 1238
4 SASI_Hs01_00146440 predicted 237
5 SASI_Hs01_00146441 predicted 511
6 SASI_Hs01_00146442 predicted 862
7 SASI_Hs01_00146443 predicted 283
8 SASI_Hs01_00146444 predicted 1136
9 SASI_Hs02_00370746 predicted 832
10 SASI_Hs01_00146445 predicted 425
11 SASI_Hs01_00146439 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076811 predicted 276
2 SASI_Mm01_00076812 predicted 262
3 SASI_Mm01_00076813 predicted 357
4 SASI_Mm01_00076814 predicted 797
5 SASI_Mm01_00076815 predicted 897
6 SASI_Mm01_00076816 predicted 651
7 SASI_Mm01_00076817 predicted 1193
8 SASI_Mm01_00076818 predicted 1077
9 SASI_Mm01_00076819 predicted 961
10 SASI_Mm01_00076820 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182608
ANKRD33 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 33
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182608.3-1732s21c1
Sequence:CCGGAGTAAGGGACAGGCTAGATTGCTCGAGCAATCTAGCCTGTCCCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-240s21c1
Sequence:CCGGCATTCGGAGACCCAGTGATTGCTCGAGCAATCACTGGGTCTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-477s21c1
Sequence:CCGGATTGGGCCTGTGTCCACAATGCTCGAGCATTGTGGACACAGGCCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-723s21c1
Sequence:CCGGGTCTCCTGCTCAACTACTATGCTCGAGCATAGTAGTTGAGCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1684s1c1
Sequence:CCGGCCTAAGTAAATCTGCTCTCAACTCGAGTTGAGAGCAGATTTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182608.2-1361s1c1
Sequence:CCGGCATATTGAGCAAGTGCCTTCACTCGAGTGAAGGCACTTGCTCAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1734s1c1
Sequence:CCGGGCATTGTTTGCAAGAGTGAAACTCGAGTTTCACTCTTGCAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182608.2-337s1c1
Sequence:CCGGGCGTTGACTGCCTCATAGATACTCGAGTATCTATGAGGCAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1743s1c1
Sequence:CCGGGCAAGAGTGAAAGAGTGGAAACTCGAGTTTCCACTCTTTCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182608
ANKRD33 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 33
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182608.3-1732s21c1
Sequence:CCGGAGTAAGGGACAGGCTAGATTGCTCGAGCAATCTAGCCTGTCCCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-240s21c1
Sequence:CCGGCATTCGGAGACCCAGTGATTGCTCGAGCAATCACTGGGTCTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-477s21c1
Sequence:CCGGATTGGGCCTGTGTCCACAATGCTCGAGCATTGTGGACACAGGCCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-723s21c1
Sequence:CCGGGTCTCCTGCTCAACTACTATGCTCGAGCATAGTAGTTGAGCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1684s1c1
Sequence:CCGGCCTAAGTAAATCTGCTCTCAACTCGAGTTGAGAGCAGATTTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182608.2-1361s1c1
Sequence:CCGGCATATTGAGCAAGTGCCTTCACTCGAGTGAAGGCACTTGCTCAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1734s1c1
Sequence:CCGGGCATTGTTTGCAAGAGTGAAACTCGAGTTTCACTCTTGCAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182608.2-337s1c1
Sequence:CCGGGCGTTGACTGCCTCATAGATACTCGAGTATCTATGAGGCAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1743s1c1
Sequence:CCGGGCAAGAGTGAAAGAGTGGAAACTCGAGTTTCCACTCTTTCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182608
ANKRD33 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 33
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182608.3-1732s21c1
Sequence:CCGGAGTAAGGGACAGGCTAGATTGCTCGAGCAATCTAGCCTGTCCCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-240s21c1
Sequence:CCGGCATTCGGAGACCCAGTGATTGCTCGAGCAATCACTGGGTCTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-477s21c1
Sequence:CCGGATTGGGCCTGTGTCCACAATGCTCGAGCATTGTGGACACAGGCCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182608.3-723s21c1
Sequence:CCGGGTCTCCTGCTCAACTACTATGCTCGAGCATAGTAGTTGAGCAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1684s1c1
Sequence:CCGGCCTAAGTAAATCTGCTCTCAACTCGAGTTGAGAGCAGATTTACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182608.2-1361s1c1
Sequence:CCGGCATATTGAGCAAGTGCCTTCACTCGAGTGAAGGCACTTGCTCAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1734s1c1
Sequence:CCGGGCATTGTTTGCAAGAGTGAAACTCGAGTTTCACTCTTGCAAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182608.2-337s1c1
Sequence:CCGGGCGTTGACTGCCTCATAGATACTCGAGTATCTATGAGGCAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182608.2-1743s1c1
Sequence:CCGGGCAAGAGTGAAAGAGTGGAAACTCGAGTTTCCACTCTTTCACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144790
ANKRD33 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 33
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-171s21c1
Sequence:CCGGACCATGGCTTTGGTTCCATTGCTCGAGCAATGGAACCAAAGCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-789s21c1
Sequence:CCGGAGCTGGGCACTAGAGGCAAATCTCGAGATTTGCCTCTAGTGCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-297s21c1
Sequence:CCGGCTCTCCTGCTCAACTACTTTGCTCGAGCAAAGTAGTTGAGCAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144790.1-1291s1c1
Sequence:CCGGACAGTGGTTATGGTAGTGATACTCGAGTATCACTACCATAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-393s1c1
Sequence:CCGGAGTGTGTAGTTGCCCTCCTTACTCGAGTAAGGAGGGCAACTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-221s1c1
Sequence:CCGGGATGTGAACCAGCAAGACAAACTCGAGTTTGTCTTGCTGGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-965s1c1
Sequence:CCGGCCTAAGATCCTCCTCTCTAAACTCGAGTTTAGAGAGGAGGATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-963s1c1
Sequence:CCGGTCCCTAAGATCCTCCTCTCTACTCGAGTAGAGAGGAGGATCTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144790
ANKRD33 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 33
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-171s21c1
Sequence:CCGGACCATGGCTTTGGTTCCATTGCTCGAGCAATGGAACCAAAGCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-789s21c1
Sequence:CCGGAGCTGGGCACTAGAGGCAAATCTCGAGATTTGCCTCTAGTGCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-297s21c1
Sequence:CCGGCTCTCCTGCTCAACTACTTTGCTCGAGCAAAGTAGTTGAGCAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144790.1-1291s1c1
Sequence:CCGGACAGTGGTTATGGTAGTGATACTCGAGTATCACTACCATAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-393s1c1
Sequence:CCGGAGTGTGTAGTTGCCCTCCTTACTCGAGTAAGGAGGGCAACTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-221s1c1
Sequence:CCGGGATGTGAACCAGCAAGACAAACTCGAGTTTGTCTTGCTGGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-965s1c1
Sequence:CCGGCCTAAGATCCTCCTCTCTAAACTCGAGTTTAGAGAGGAGGATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-963s1c1
Sequence:CCGGTCCCTAAGATCCTCCTCTCTACTCGAGTAGAGAGGAGGATCTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144790
ANKRD33 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 33
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-171s21c1
Sequence:CCGGACCATGGCTTTGGTTCCATTGCTCGAGCAATGGAACCAAAGCCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-789s21c1
Sequence:CCGGAGCTGGGCACTAGAGGCAAATCTCGAGATTTGCCTCTAGTGCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144790.1-297s21c1
Sequence:CCGGCTCTCCTGCTCAACTACTTTGCTCGAGCAAAGTAGTTGAGCAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144790.1-1291s1c1
Sequence:CCGGACAGTGGTTATGGTAGTGATACTCGAGTATCACTACCATAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-393s1c1
Sequence:CCGGAGTGTGTAGTTGCCCTCCTTACTCGAGTAAGGAGGGCAACTACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-221s1c1
Sequence:CCGGGATGTGAACCAGCAAGACAAACTCGAGTTTGTCTTGCTGGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-965s1c1
Sequence:CCGGCCTAAGATCCTCCTCTCTAAACTCGAGTTTAGAGAGGAGGATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144790.1-963s1c1
Sequence:CCGGTCCCTAAGATCCTCCTCTCTACTCGAGTAGAGAGGAGGATCTTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks