EMAIL THIS PAGE TO A FRIEND

ANKRD33B

ankyrin repeat domain 33B

82 Gene Product Result for
UniProtKB ID: A6NCL7
Gene ID:
Mouse(67434) ankyrin repeat domain 33B
Rat(310200) ankyrin repeat domain 33B
chicken(420924) ankyrin repeat domain 33B
dog(488049) ankyrin repeat domain-containing protein 33B-like
cow(518403) ankyrin repeat domain 33B
naked mole-rat(101702511) ankyrin repeat domain 33B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001130634 Rosetta Predictions human pricing
XM_001723774 Rosetta Predictions human pricing
XM_940961 Rosetta Predictions human pricing
XM_001065785 Rosetta Predictions rat pricing
XM_226907 Rosetta Predictions rat pricing
NM_026153 Rosetta Predictions mouse pricing
NM_027496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001130634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00387503 predicted 292
2 SASI_Hs02_00387504 predicted 1951
3 SASI_Hs02_00387505 predicted 1948
4 SASI_Hs02_00387506 predicted 576
5 SASI_Hs02_00387507 predicted 2096
6 SASI_Hs02_00387508 predicted 1994
7 SASI_Hs02_00387509 predicted 2027
8 SASI_Hs02_00387510 predicted 2234
9 SASI_Hs02_00387511 predicted 2000
10 SASI_Hs02_00387512 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457510 predicted 361
2 SASI_Hs02_00457511 predicted 561
3 SASI_Hs02_00457512 predicted 343
4 SASI_Hs02_00457513 predicted 558
5 SASI_Hs02_00457514 predicted 549
6 SASI_Hs02_00457515 predicted 498
7 SASI_Hs02_00457516 predicted 633
8 SASI_Hs02_00457517 predicted 843
9 SASI_Hs02_00457518 predicted 613
10 SASI_Hs02_00457519 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484516 predicted 1904
2 SASI_Hs02_00484517 predicted 2104
3 SASI_Hs02_00484518 predicted 1880
4 SASI_Hs02_00484519 predicted 578
5 SASI_Hs02_00484520 predicted 2083
6 SASI_Hs02_00484521 predicted 2168
7 SASI_Hs02_00484522 predicted 2386
8 SASI_Hs02_00484523 predicted 2144
9 SASI_Hs02_00484524 predicted 1914
10 SASI_Hs02_00484525 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315354 predicted 1080
2 SASI_Rn02_00315355 predicted 1591
3 SASI_Rn02_00315356 predicted 725
4 SASI_Rn02_00315357 predicted 675
5 SASI_Rn02_00315358 predicted 494
6 SASI_Rn02_00315359 predicted 917
7 SASI_Rn02_00315360 predicted 271
8 SASI_Rn02_00315361 predicted 481
9 SASI_Rn02_00315362 predicted 809
10 SASI_Rn02_00315363 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383951 predicted 1083
2 SASI_Rn02_00383952 predicted 1594
3 SASI_Rn02_00383953 predicted 723
4 SASI_Rn02_00383954 predicted 676
5 SASI_Rn02_00383955 predicted 489
6 SASI_Rn02_00383956 predicted 923
7 SASI_Rn02_00383957 predicted 273
8 SASI_Rn02_00383958 predicted 479
9 SASI_Rn02_00383959 predicted 805
10 SASI_Rn02_00383960 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061038 predicted 838
2 SASI_Mm01_00061039 predicted 810
3 SASI_Mm01_00061040 predicted 774
4 SASI_Mm01_00061041 predicted 672
5 SASI_Mm01_00061042 predicted 554
6 SASI_Mm01_00061043 predicted 920
7 SASI_Mm01_00061044 predicted 569
8 SASI_Mm01_00061045 predicted 525
9 SASI_Mm01_00061047 predicted 235
10 SASI_Mm02_00329768 predicted 517
11 SASI_Mm01_00061046 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052282 predicted 1838
2 SASI_Mm01_00052283 predicted 1087
3 SASI_Mm01_00052285 predicted 726
4 SASI_Mm01_00052286 predicted 1146
5 SASI_Mm01_00052287 predicted 502
6 SASI_Mm01_00052288 predicted 694
7 SASI_Mm02_00332323 predicted 739
8 SASI_Mm01_00052289 predicted 740
9 SASI_Mm01_00052290 predicted 695
10 SASI_Mm01_00052291 predicted 246
11 SASI_Mm01_00052284 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026153
ANKRD33B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 33B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-279s1c1
Sequence:CCGGGTACGAAGACTTCTCTAGTCTCTCGAGAGACTAGAGAAGTCTTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-277s1c1
Sequence:CCGGGAGTACGAAGACTTCTCTAGTCTCGAGACTAGAGAAGTCTTCGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-274s1c1
Sequence:CCGGGAGGAGTACGAAGACTTCTCTCTCGAGAGAGAAGTCTTCGTACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-352s1c1
Sequence:CCGGAGGAAGAGTACGGCTCGGTGACTCGAGTCACCGAGCCGTACTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-251s1c1
Sequence:CCGGAGGAGAAGACCCAGCGGACTACTCGAGTAGTCCGCTGGGTCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-315s1c1
Sequence:CCGGATCGCATCGGACGATTCCTTCCTCGAGGAAGGAATCGTCCGATGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-541s1c1
Sequence:CCGGTCCGGTGACTCCTGGATGCATCTCGAGATGCATCCAGGAGTCACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026153
ANKRD33B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 33B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-279s1c1
Sequence:CCGGGTACGAAGACTTCTCTAGTCTCTCGAGAGACTAGAGAAGTCTTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-277s1c1
Sequence:CCGGGAGTACGAAGACTTCTCTAGTCTCGAGACTAGAGAAGTCTTCGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-274s1c1
Sequence:CCGGGAGGAGTACGAAGACTTCTCTCTCGAGAGAGAAGTCTTCGTACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-352s1c1
Sequence:CCGGAGGAAGAGTACGGCTCGGTGACTCGAGTCACCGAGCCGTACTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-251s1c1
Sequence:CCGGAGGAGAAGACCCAGCGGACTACTCGAGTAGTCCGCTGGGTCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-315s1c1
Sequence:CCGGATCGCATCGGACGATTCCTTCCTCGAGGAAGGAATCGTCCGATGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-541s1c1
Sequence:CCGGTCCGGTGACTCCTGGATGCATCTCGAGATGCATCCAGGAGTCACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026153
ANKRD33B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 33B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-279s1c1
Sequence:CCGGGTACGAAGACTTCTCTAGTCTCTCGAGAGACTAGAGAAGTCTTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-277s1c1
Sequence:CCGGGAGTACGAAGACTTCTCTAGTCTCGAGACTAGAGAAGTCTTCGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.1-274s1c1
Sequence:CCGGGAGGAGTACGAAGACTTCTCTCTCGAGAGAGAAGTCTTCGTACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-352s1c1
Sequence:CCGGAGGAAGAGTACGGCTCGGTGACTCGAGTCACCGAGCCGTACTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-251s1c1
Sequence:CCGGAGGAGAAGACCCAGCGGACTACTCGAGTAGTCCGCTGGGTCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-315s1c1
Sequence:CCGGATCGCATCGGACGATTCCTTCCTCGAGGAAGGAATCGTCCGATGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026153.2-541s1c1
Sequence:CCGGTCCGGTGACTCCTGGATGCATCTCGAGATGCATCCAGGAGTCACCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)