EMAIL THIS PAGE TO A FRIEND

ANKRD34B

ankyrin repeat domain 34B

51 Gene Product Result for
Synonyms: DP58
UniProtKB ID: A5PLL1, B2RPH1, Q68D79
Gene ID:
Mouse(218440) ankyrin repeat domain 34B
Rat(499506) ankyrin repeat domain 34B
sheep(101121170) ankyrin repeat domain 34B
domestic guinea pig(100732252) ankyrin repeat domain 34B
naked mole-rat(101698429) ankyrin repeat domain 34B
chicken(431626) ankyrin repeat domain 34B
dog(488927) ankyrin repeat domain 34B
Horse(100073257) ankyrin repeat domain 34B
cow(529927) ankyrin repeat domain 34B
domestic cat(101087706) ankyrin repeat domain 34B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004441 Rosetta Predictions human pricing
NM_001109174 Rosetta Predictions rat pricing
NM_175455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230271 predicted 853
2 SASI_Hs01_00230272 predicted 1488
3 SASI_Hs01_00230273 predicted 808
4 SASI_Hs01_00230274 predicted 1667
5 SASI_Hs01_00230275 predicted 897
6 SASI_Hs01_00230276 predicted 1763
7 SASI_Hs01_00230277 predicted 1994
8 SASI_Hs01_00230278 predicted 793
9 SASI_Hs01_00230279 predicted 1343
10 SASI_Hs01_00230280 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245850 predicted 968
2 SASI_Rn02_00245851 predicted 1977
3 SASI_Rn02_00245852 predicted 617
4 SASI_Rn02_00245853 predicted 643
5 SASI_Rn02_00245854 predicted 2144
6 SASI_Rn02_00245855 predicted 1559
7 SASI_Rn02_00245856 predicted 1467
8 SASI_Rn02_00245857 predicted 809
9 SASI_Rn02_00245858 predicted 1940
10 SASI_Rn02_00245859 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346357 predicted 542
2 SASI_Mm01_00083066 predicted 1153
3 SASI_Mm01_00083067 predicted 640
4 SASI_Mm02_00346358 predicted 1858
5 SASI_Mm02_00346359 predicted 1385
6 SASI_Mm01_00083069 predicted 948
7 SASI_Mm01_00083070 predicted 1161
8 SASI_Mm01_00083071 predicted 1906
9 SASI_Mm01_00083072 predicted 730
10 SASI_Mm01_00083073 predicted 1234
11 SASI_Mm01_00083065 predicted 2112
12 SASI_Mm01_00083068 predicted 1861
13 SASI_Mm01_00083074 predicted 1970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175455
ANKRD34B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175455.2-2288s1c1
Sequence:CCGGGCACAGCTTAATACATAGCTTCTCGAGAAGCTATGTATTAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1666s1c1
Sequence:CCGGCGCTGAAGAGTATAGTTCAAACTCGAGTTTGAACTATACTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1163s1c1
Sequence:CCGGGCCTTCGGAAATTGACATCAACTCGAGTTGATGTCAATTTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2280s21c1
Sequence:CCGGGTCCAATATTTATCAACTTTCCTCGAGGAAAGTTGATAAATATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-2038s21c1
Sequence:CCGGACGGAACAAATTAAGCAATTACTCGAGTAATTGCTTAATTTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-1413s21c1
Sequence:CCGGGCACCAGAGCATCGATGTAAACTCGAGTTTACATCGATGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2159s21c1
Sequence:CCGGGTGCATCGCAGCTAGGCAAATCTCGAGATTTGCCTAGCTGCGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175455
ANKRD34B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175455.2-2288s1c1
Sequence:CCGGGCACAGCTTAATACATAGCTTCTCGAGAAGCTATGTATTAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1666s1c1
Sequence:CCGGCGCTGAAGAGTATAGTTCAAACTCGAGTTTGAACTATACTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1163s1c1
Sequence:CCGGGCCTTCGGAAATTGACATCAACTCGAGTTGATGTCAATTTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2280s21c1
Sequence:CCGGGTCCAATATTTATCAACTTTCCTCGAGGAAAGTTGATAAATATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-2038s21c1
Sequence:CCGGACGGAACAAATTAAGCAATTACTCGAGTAATTGCTTAATTTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-1413s21c1
Sequence:CCGGGCACCAGAGCATCGATGTAAACTCGAGTTTACATCGATGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2159s21c1
Sequence:CCGGGTGCATCGCAGCTAGGCAAATCTCGAGATTTGCCTAGCTGCGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175455
ANKRD34B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175455.2-2288s1c1
Sequence:CCGGGCACAGCTTAATACATAGCTTCTCGAGAAGCTATGTATTAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1666s1c1
Sequence:CCGGCGCTGAAGAGTATAGTTCAAACTCGAGTTTGAACTATACTCTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175455.2-1163s1c1
Sequence:CCGGGCCTTCGGAAATTGACATCAACTCGAGTTGATGTCAATTTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2280s21c1
Sequence:CCGGGTCCAATATTTATCAACTTTCCTCGAGGAAAGTTGATAAATATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-2038s21c1
Sequence:CCGGACGGAACAAATTAAGCAATTACTCGAGTAATTGCTTAATTTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175455.4-1413s21c1
Sequence:CCGGGCACCAGAGCATCGATGTAAACTCGAGTTTACATCGATGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175455.4-2159s21c1
Sequence:CCGGGTGCATCGCAGCTAGGCAAATCTCGAGATTTGCCTAGCTGCGATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004441
ANKRD34B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3296s1c1
Sequence:CCGGGCAGCTTAACAACAAAGGATACTCGAGTATCCTTTGTTGTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-611s1c1
Sequence:CCGGCGCTTGTAAGACCAAACATGTCTCGAGACATGTTTGGTCTTACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-1617s1c1
Sequence:CCGGGAAGACGGCAAAGCACTTATACTCGAGTATAAGTGCTTTGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-975s1c1
Sequence:CCGGCCTGTGGATATAGATGGGTGTCTCGAGACACCCATCTATATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-689s1c1
Sequence:CCGGCGATCCCAACATACAGGACAACTCGAGTTGTCCTGTATGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004441.1-2293s1c1
Sequence:CCGGCAAAGAAAGAAGGCCACGTATCTCGAGATACGTGGCCTTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-672s1c1
Sequence:CCGGCTGTTAGAGAACAATGCCGATCTCGAGATCGGCATTGTTCTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3167s1c1
Sequence:CCGGCCTGTGAATAACTTCCAACAACTCGAGTTGTTGGAAGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004441
ANKRD34B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3296s1c1
Sequence:CCGGGCAGCTTAACAACAAAGGATACTCGAGTATCCTTTGTTGTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-611s1c1
Sequence:CCGGCGCTTGTAAGACCAAACATGTCTCGAGACATGTTTGGTCTTACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-1617s1c1
Sequence:CCGGGAAGACGGCAAAGCACTTATACTCGAGTATAAGTGCTTTGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-975s1c1
Sequence:CCGGCCTGTGGATATAGATGGGTGTCTCGAGACACCCATCTATATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-689s1c1
Sequence:CCGGCGATCCCAACATACAGGACAACTCGAGTTGTCCTGTATGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004441.1-2293s1c1
Sequence:CCGGCAAAGAAAGAAGGCCACGTATCTCGAGATACGTGGCCTTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-672s1c1
Sequence:CCGGCTGTTAGAGAACAATGCCGATCTCGAGATCGGCATTGTTCTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3167s1c1
Sequence:CCGGCCTGTGAATAACTTCCAACAACTCGAGTTGTTGGAAGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004441
ANKRD34B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3296s1c1
Sequence:CCGGGCAGCTTAACAACAAAGGATACTCGAGTATCCTTTGTTGTTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-611s1c1
Sequence:CCGGCGCTTGTAAGACCAAACATGTCTCGAGACATGTTTGGTCTTACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-1617s1c1
Sequence:CCGGGAAGACGGCAAAGCACTTATACTCGAGTATAAGTGCTTTGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-975s1c1
Sequence:CCGGCCTGTGGATATAGATGGGTGTCTCGAGACACCCATCTATATCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004441.1-689s1c1
Sequence:CCGGCGATCCCAACATACAGGACAACTCGAGTTGTCCTGTATGTTGGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004441.1-2293s1c1
Sequence:CCGGCAAAGAAAGAAGGCCACGTATCTCGAGATACGTGGCCTTCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004441.1-672s1c1
Sequence:CCGGCTGTTAGAGAACAATGCCGATCTCGAGATCGGCATTGTTCTCTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004441.1-3167s1c1
Sequence:CCGGCCTGTGAATAACTTCCAACAACTCGAGTTGTTGGAAGTTATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks