EMAIL THIS PAGE TO A FRIEND

ANKRD34C

ankyrin repeat domain 34C

76 Gene Product Result for
UniProtKB ID: P0C6C1, H3BNM1
Gene ID:
Mouse(330998) ankyrin repeat domain 34C
Rat(300889) ankyrin repeat domain 34C
chicken(415579) ankyrin repeat domain 34C
cow(100297143) ankyrin repeat domain 34C
Horse(100059741) ankyrin repeat domain 34C
domestic cat(101086231) ankyrin repeat domain 34C
dog(488773) ankyrin repeat domain 34C
naked mole-rat(101698777) ankyrin repeat domain 34C
domestic guinea pig(101787142) ankyrin repeat domain 34C
sheep(101113278) ankyrin repeat domain 34C
Domestic Rabbit(100340102) ankyrin repeat domain 34C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220601 MISSION® esiRNA esiRNA targeting human ANKRD34C human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719889 Rosetta Predictions human pricing
XM_372584 Rosetta Predictions human pricing
XM_930512 Rosetta Predictions human pricing
XM_939324 Rosetta Predictions human pricing
NM_001106845 Rosetta Predictions rat pricing
NM_207260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433216 predicted 1125
2 SASI_Hs02_00433217 predicted 378
3 SASI_Hs02_00433218 predicted 638
4 SASI_Hs02_00433219 predicted 890
5 SASI_Hs02_00433220 predicted 1190
6 SASI_Hs02_00433221 predicted 1406
7 SASI_Hs02_00433222 predicted 1601
8 SASI_Hs02_00433223 predicted 536
9 SASI_Hs02_00433224 predicted 1194
10 SASI_Hs02_00433225 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251264 predicted 1593
2 SASI_Hs01_00251265 predicted 956
3 SASI_Hs01_00251266 predicted 1298
4 SASI_Hs01_00251267 predicted 1108
5 SASI_Hs01_00251268 predicted 1325
6 SASI_Hs01_00251269 predicted 1759
7 SASI_Hs01_00251270 predicted 997
8 SASI_Hs01_00251271 predicted 1420
9 SASI_Hs01_00251272 predicted 904
10 SASI_Hs01_00251273 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263986 predicted 1126
2 SASI_Hs01_00263987 predicted 384
3 SASI_Hs01_00263990 predicted 637
4 SASI_Hs02_00481309 predicted 893
5 SASI_Hs01_00263992 predicted 1191
6 SASI_Hs02_00481310 predicted 1413
7 SASI_Hs02_00481311 predicted 1600
8 SASI_Hs01_00263993 predicted 536
9 SASI_Hs02_00481312 predicted 1199
10 SASI_Hs01_00263994 predicted 238
11 SASI_Hs01_00263985 predicted 299
12 SASI_Hs01_00263988 predicted 486
13 SASI_Hs01_00263989 predicted 833
14 SASI_Hs01_00263991 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483557 predicted 1126
2 SASI_Hs02_00483558 predicted 381
3 SASI_Hs02_00483559 predicted 636
4 SASI_Hs02_00483560 predicted 896
5 SASI_Hs02_00483561 predicted 1193
6 SASI_Hs02_00483562 predicted 1414
7 SASI_Hs02_00483563 predicted 1606
8 SASI_Hs02_00483564 predicted 532
9 SASI_Hs02_00483565 predicted 1198
10 SASI_Hs02_00483566 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222966 predicted 1569
2 SASI_Rn02_00222967 predicted 824
3 SASI_Rn02_00222968 predicted 627
4 SASI_Rn02_00222969 predicted 2096
5 SASI_Rn02_00222970 predicted 1250
6 SASI_Rn02_00222971 predicted 1101
7 SASI_Rn02_00222972 predicted 867
8 SASI_Rn02_00222973 predicted 1545
9 SASI_Rn02_00222974 predicted 906
10 SASI_Rn02_00222975 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025352 predicted 448
2 SASI_Mm01_00025353 predicted 2055
3 SASI_Mm01_00025354 predicted 1561
4 SASI_Mm01_00025355 predicted 673
5 SASI_Mm01_00025356 predicted 628
6 SASI_Mm01_00025357 predicted 1200
7 SASI_Mm01_00025358 predicted 983
8 SASI_Mm02_00352000 predicted 1280
9 SASI_Mm01_00025359 predicted 534
10 SASI_Mm01_00025360 predicted 1096
11 SASI_Mm01_00025361 predicted 1949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146341
ANKRD34C MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146341.1-2503s21c1
Sequence:CCGGCAAACCCTCAGTGACTAAATCCTCGAGGATTTAGTCACTGAGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-956s21c1
Sequence:CCGGACCACCAAACAGTATCTTAATCTCGAGATTAAGATACTGTTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1871s21c1
Sequence:CCGGGTGAATCTGAACCCGCCTATTCTCGAGAATAGGCGGGTTCAGATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1315s21c1
Sequence:CCGGCAAGAGCATCAGTGATATATCCTCGAGGATATATCACTGATGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1816s21c1
Sequence:CCGGTCTGCTCCTTGATCGCATTTCCTCGAGGAAATGCGATCAAGGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146341
ANKRD34C MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146341.1-2503s21c1
Sequence:CCGGCAAACCCTCAGTGACTAAATCCTCGAGGATTTAGTCACTGAGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-956s21c1
Sequence:CCGGACCACCAAACAGTATCTTAATCTCGAGATTAAGATACTGTTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1871s21c1
Sequence:CCGGGTGAATCTGAACCCGCCTATTCTCGAGAATAGGCGGGTTCAGATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1315s21c1
Sequence:CCGGCAAGAGCATCAGTGATATATCCTCGAGGATATATCACTGATGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1816s21c1
Sequence:CCGGTCTGCTCCTTGATCGCATTTCCTCGAGGAAATGCGATCAAGGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146341
ANKRD34C MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146341.1-2503s21c1
Sequence:CCGGCAAACCCTCAGTGACTAAATCCTCGAGGATTTAGTCACTGAGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-956s21c1
Sequence:CCGGACCACCAAACAGTATCTTAATCTCGAGATTAAGATACTGTTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1871s21c1
Sequence:CCGGGTGAATCTGAACCCGCCTATTCTCGAGAATAGGCGGGTTCAGATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1315s21c1
Sequence:CCGGCAAGAGCATCAGTGATATATCCTCGAGGATATATCACTGATGCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146341.1-1816s21c1
Sequence:CCGGTCTGCTCCTTGATCGCATTTCCTCGAGGAAATGCGATCAAGGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284530
ANKRD34C MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284530.1-2259s1c1
Sequence:CCGGGCTGTTGTTGTGCATACTAAACTCGAGTTTAGTATGCACAACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-952s1c1
Sequence:CCGGCATCACCCAAAGTGGAAGATACTCGAGTATCTTCCACTTTGGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-1627s1c1
Sequence:CCGGCAGGCAAAGGACCTTTAGATACTCGAGTATCTAAAGGTCCTTTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-464s1c1
Sequence:CCGGGACTGATGGAAACTCTCTCTTCTCGAGAAGAGAGAGTTTCCATCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-801s1c1
Sequence:CCGGGCTCTGGTTTATGCAATAAATCTCGAGATTTATTGCATAAACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284530
ANKRD34C MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284530.1-2259s1c1
Sequence:CCGGGCTGTTGTTGTGCATACTAAACTCGAGTTTAGTATGCACAACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-952s1c1
Sequence:CCGGCATCACCCAAAGTGGAAGATACTCGAGTATCTTCCACTTTGGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-1627s1c1
Sequence:CCGGCAGGCAAAGGACCTTTAGATACTCGAGTATCTAAAGGTCCTTTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-464s1c1
Sequence:CCGGGACTGATGGAAACTCTCTCTTCTCGAGAAGAGAGAGTTTCCATCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-801s1c1
Sequence:CCGGGCTCTGGTTTATGCAATAAATCTCGAGATTTATTGCATAAACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284530
ANKRD34C MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284530.1-2259s1c1
Sequence:CCGGGCTGTTGTTGTGCATACTAAACTCGAGTTTAGTATGCACAACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-952s1c1
Sequence:CCGGCATCACCCAAAGTGGAAGATACTCGAGTATCTTCCACTTTGGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-1627s1c1
Sequence:CCGGCAGGCAAAGGACCTTTAGATACTCGAGTATCTAAAGGTCCTTTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-464s1c1
Sequence:CCGGGACTGATGGAAACTCTCTCTTCTCGAGAAGAGAGAGTTTCCATCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284530.1-801s1c1
Sequence:CCGGGCTCTGGTTTATGCAATAAATCTCGAGATTTATTGCATAAACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)