EMAIL THIS PAGE TO A FRIEND

ANKRD35

ankyrin repeat domain 35

75 Gene Product Result for
UniProtKB ID: Q8N283, A6NEU0, Q3MJ10, Q96LS3
Gene ID:
Mouse(213121) ankyrin repeat domain 35
Rat(365881) ankyrin repeat domain 35
sheep(101117123) ankyrin repeat domain 35
Domestic Rabbit(100340763) ankyrin repeat domain 35
domestic guinea pig(100730591) ankyrin repeat domain 35
naked mole-rat(101699591) ankyrin repeat domain 35
cow(514513) ankyrin repeat domain 35
Horse(100065173) ankyrin repeat domain 35
domestic cat(101086410) ankyrin repeat domain 35
dog(475825) ankyrin repeat domain 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144698 Rosetta Predictions human pricing
XM_001063190 Rosetta Predictions rat pricing
XM_345258 Rosetta Predictions rat pricing
NM_001081139 Rosetta Predictions mouse pricing
XM_143418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150695 predicted 772
2 SASI_Hs01_00150696 predicted 1075
3 SASI_Hs01_00150697 predicted 298
4 SASI_Hs02_00364623 predicted 354
5 SASI_Hs01_00150698 predicted 1957
6 SASI_Hs01_00150700 predicted 1510
7 SASI_Hs01_00150701 predicted 1563
8 SASI_Hs01_00150702 predicted 1561
9 SASI_Hs01_00150703 predicted 306
10 SASI_Hs02_00364624 predicted 408
11 SASI_Hs01_00150699 predicted 1427
12 SASI_Hs01_00150704 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306178 predicted 544
2 SASI_Rn02_00306179 predicted 2856
3 SASI_Rn02_00306180 predicted 958
4 SASI_Rn02_00306181 predicted 638
5 SASI_Rn02_00306182 predicted 1662
6 SASI_Rn02_00306183 predicted 639
7 SASI_Rn02_00306184 predicted 1366
8 SASI_Rn02_00306185 predicted 1409
9 SASI_Rn02_00306186 predicted 2514
10 SASI_Rn02_00306187 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398116 predicted 978
2 SASI_Rn02_00398117 predicted 647
3 SASI_Rn02_00398118 predicted 1679
4 SASI_Rn02_00398119 predicted 659
5 SASI_Rn02_00398120 predicted 1387
6 SASI_Rn02_00398121 predicted 1426
7 SASI_Rn02_00398122 predicted 1149
8 SASI_Rn02_00398123 predicted 1005
9 SASI_Rn02_00398124 predicted 1871
10 SASI_Rn02_00398125 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295561 predicted 3177
2 SASI_Mm02_00295562 predicted 2616
3 SASI_Mm02_00295563 predicted 1085
4 SASI_Mm02_00295564 predicted 1728
5 SASI_Mm02_00295565 predicted 1278
6 SASI_Mm02_00295566 predicted 1689
7 SASI_Mm02_00295567 predicted 482
8 SASI_Mm02_00295568 predicted 1231
9 SASI_Mm02_00295569 predicted 2325
10 SASI_Mm02_00295570 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243350 predicted 3177
2 SASI_Mm01_00243351 predicted 2622
3 SASI_Mm01_00243352 predicted 2690
4 SASI_Mm01_00243353 predicted 1090
5 SASI_Mm01_00243354 predicted 1728
6 SASI_Mm01_00243355 predicted 1283
7 SASI_Mm01_00243356 predicted 1685
8 SASI_Mm01_00243357 predicted 1235
9 SASI_Mm01_00243358 predicted 2333
10 SASI_Mm01_00243359 predicted 2183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144698
ANKRD35 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 35
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144698.2-3109s1c1
Sequence:CCGGCGAGATTCTCTGTTGGAATAACTCGAGTTATTCCAACAGAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-268s1c1
Sequence:CCGGCCTGACAGAATGTCTGACTATCTCGAGATAGTCAGACATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-603s1c1
Sequence:CCGGCCCGAGTTAATGTTACAGACACTCGAGTGTCTGTAACATTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-604s1c1
Sequence:CCGGCCGAGTTAATGTTACAGACAACTCGAGTTGTCTGTAACATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-2599s21c1
Sequence:CCGGAGCCTACGGCAACACGAGAAACTCGAGTTTCTCGTGTTGCCGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-1245s21c1
Sequence:CCGGTGAGAGTACACAAGAGCTAAACTCGAGTTTAGCTCTTGTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-3023s21c1
Sequence:CCGGACAGGAATCATCTACTGAATGCTCGAGCATTCAGTAGATGATTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144698
ANKRD35 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 35
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144698.2-3109s1c1
Sequence:CCGGCGAGATTCTCTGTTGGAATAACTCGAGTTATTCCAACAGAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-268s1c1
Sequence:CCGGCCTGACAGAATGTCTGACTATCTCGAGATAGTCAGACATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-603s1c1
Sequence:CCGGCCCGAGTTAATGTTACAGACACTCGAGTGTCTGTAACATTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-604s1c1
Sequence:CCGGCCGAGTTAATGTTACAGACAACTCGAGTTGTCTGTAACATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-2599s21c1
Sequence:CCGGAGCCTACGGCAACACGAGAAACTCGAGTTTCTCGTGTTGCCGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-1245s21c1
Sequence:CCGGTGAGAGTACACAAGAGCTAAACTCGAGTTTAGCTCTTGTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-3023s21c1
Sequence:CCGGACAGGAATCATCTACTGAATGCTCGAGCATTCAGTAGATGATTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144698
ANKRD35 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 35
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144698.2-3109s1c1
Sequence:CCGGCGAGATTCTCTGTTGGAATAACTCGAGTTATTCCAACAGAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-268s1c1
Sequence:CCGGCCTGACAGAATGTCTGACTATCTCGAGATAGTCAGACATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-603s1c1
Sequence:CCGGCCCGAGTTAATGTTACAGACACTCGAGTGTCTGTAACATTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144698.2-604s1c1
Sequence:CCGGCCGAGTTAATGTTACAGACAACTCGAGTTGTCTGTAACATTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-2599s21c1
Sequence:CCGGAGCCTACGGCAACACGAGAAACTCGAGTTTCTCGTGTTGCCGTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-1245s21c1
Sequence:CCGGTGAGAGTACACAAGAGCTAAACTCGAGTTTAGCTCTTGTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144698.3-3023s21c1
Sequence:CCGGACAGGAATCATCTACTGAATGCTCGAGCATTCAGTAGATGATTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081139
ANKRD35 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-1443s21c1
Sequence:CCGGAGAAGGCACTGGCTACAATAACTCGAGTTATTGTAGCCAGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-597s21c1
Sequence:CCGGTGCTTCAGCACGGTGCTAATGCTCGAGCATTAGCACCGTGCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081139.1-3785s21c1
Sequence:CCGGAGACCCTTTAACACGTCAATGCTCGAGCATTGACGTGTTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-800s21c1
Sequence:CCGGCAGAGAGGTGCCCGAGTTAATCTCGAGATTAACTCGGGCACCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-2848s21c1
Sequence:CCGGCAACACAGCCTGTCGGGAAATCTCGAGATTTCCCGACAGGCTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081139
ANKRD35 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-1443s21c1
Sequence:CCGGAGAAGGCACTGGCTACAATAACTCGAGTTATTGTAGCCAGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-597s21c1
Sequence:CCGGTGCTTCAGCACGGTGCTAATGCTCGAGCATTAGCACCGTGCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081139.1-3785s21c1
Sequence:CCGGAGACCCTTTAACACGTCAATGCTCGAGCATTGACGTGTTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-800s21c1
Sequence:CCGGCAGAGAGGTGCCCGAGTTAATCTCGAGATTAACTCGGGCACCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-2848s21c1
Sequence:CCGGCAACACAGCCTGTCGGGAAATCTCGAGATTTCCCGACAGGCTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081139
ANKRD35 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-1443s21c1
Sequence:CCGGAGAAGGCACTGGCTACAATAACTCGAGTTATTGTAGCCAGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-597s21c1
Sequence:CCGGTGCTTCAGCACGGTGCTAATGCTCGAGCATTAGCACCGTGCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081139.1-3785s21c1
Sequence:CCGGAGACCCTTTAACACGTCAATGCTCGAGCATTGACGTGTTAAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-800s21c1
Sequence:CCGGCAGAGAGGTGCCCGAGTTAATCTCGAGATTAACTCGGGCACCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081139.1-2848s21c1
Sequence:CCGGCAACACAGCCTGTCGGGAAATCTCGAGATTTCCCGACAGGCTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks