EMAIL THIS PAGE TO A FRIEND

ANKRD36B

ankyrin repeat domain 36B

22 Gene Product Result for
Synonyms: KIAA1641
Species: Human ANKRD36B(57730)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302379 ANTI-U634B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025190 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109841 MISSION® esiRNA esiRNA human ANKRD36B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020970 Rosetta Predictions human pricing
NM_025190 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023653 predicted 435
2 SASI_Hs01_00023654 predicted 411
3 SASI_Hs01_00023655 predicted 438
4 SASI_Hs01_00023656 predicted 314
5 SASI_Hs01_00023657 predicted 424
6 SASI_Hs01_00023658 predicted 417
7 SASI_Hs01_00023659 predicted 423
8 SASI_Hs01_00023660 predicted 550
9 SASI_Hs01_00023661 predicted 471
10 SASI_Hs01_00023662 predicted 45
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357955 predicted 4253
2 SASI_Hs02_00357956 predicted 1202
3 SASI_Hs02_00357957 predicted 3395
4 SASI_Hs02_00357958 predicted 1327
5 SASI_Hs02_00357959 predicted 1203
6 SASI_Hs02_00357960 predicted 4247
7 SASI_Hs02_00357961 predicted 4172
8 SASI_Hs02_00357962 predicted 4175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020970
ANKRD36B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36B
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-95s1c1
Sequence:CCGGGAGAAAGCAGAAAGAGAAGTACTCGAGTACTTCTCTTTCTGCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-269s1c1
Sequence:CCGGCAAGAAATACAGGATCAACTTCTCGAGAAGTTGATCCTGTATTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020970
ANKRD36B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36B
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-95s1c1
Sequence:CCGGGAGAAAGCAGAAAGAGAAGTACTCGAGTACTTCTCTTTCTGCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-269s1c1
Sequence:CCGGCAAGAAATACAGGATCAACTTCTCGAGAAGTTGATCCTGTATTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020970
ANKRD36B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36B
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-95s1c1
Sequence:CCGGGAGAAAGCAGAAAGAGAAGTACTCGAGTACTTCTCTTTCTGCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020970.1-269s1c1
Sequence:CCGGCAAGAAATACAGGATCAACTTCTCGAGAAGTTGATCCTGTATTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025190
ANKRD36B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4893s21c1
Sequence:CCGGCACTCCCTGTTGCTCACATTACTCGAGTAATGTGAGCAACAGGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5315s21c1
Sequence:CCGGTCTGCACTAGAATCTACTAATCTCGAGATTAGTAGATTCTAGTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4566s21c1
Sequence:CCGGATACTTAACTGCCATGATAATCTCGAGATTATCATGGCAGTTAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4462s21c1
Sequence:CCGGGGGCGGACCGTATCATCTTTACTCGAGTAAAGATGATACGGTCCGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5068s21c1
Sequence:CCGGACGATGGGACCATCTAGTTACCTCGAGGTAACTAGATGGTCCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025190
ANKRD36B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4893s21c1
Sequence:CCGGCACTCCCTGTTGCTCACATTACTCGAGTAATGTGAGCAACAGGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5315s21c1
Sequence:CCGGTCTGCACTAGAATCTACTAATCTCGAGATTAGTAGATTCTAGTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4566s21c1
Sequence:CCGGATACTTAACTGCCATGATAATCTCGAGATTATCATGGCAGTTAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4462s21c1
Sequence:CCGGGGGCGGACCGTATCATCTTTACTCGAGTAAAGATGATACGGTCCGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5068s21c1
Sequence:CCGGACGATGGGACCATCTAGTTACCTCGAGGTAACTAGATGGTCCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025190
ANKRD36B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4893s21c1
Sequence:CCGGCACTCCCTGTTGCTCACATTACTCGAGTAATGTGAGCAACAGGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5315s21c1
Sequence:CCGGTCTGCACTAGAATCTACTAATCTCGAGATTAGTAGATTCTAGTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4566s21c1
Sequence:CCGGATACTTAACTGCCATGATAATCTCGAGATTATCATGGCAGTTAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-4462s21c1
Sequence:CCGGGGGCGGACCGTATCATCTTTACTCGAGTAAAGATGATACGGTCCGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025190.2-5068s21c1
Sequence:CCGGACGATGGGACCATCTAGTTACCTCGAGGTAACTAGATGGTCCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)