EMAIL THIS PAGE TO A FRIEND

ANKRD36C

ankyrin repeat domain 36C

31 Gene Product Result for
Species: Human ANKRD36C(400986)
UniProtKB ID: Q5JPF3, C9JZ08, Q15694, Q53S06, Q658V2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010914 Rosetta Predictions human pricing
XM_001714165 Rosetta Predictions human pricing
XM_001714685 Rosetta Predictions human pricing
XM_001717763 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109832 predicted 1853
2 SASI_Hs01_00109833 predicted 1436
3 SASI_Hs01_00109834 predicted 1662
4 SASI_Hs01_00109835 predicted 1600
5 SASI_Hs01_00109836 predicted 1649
6 SASI_Hs01_00109837 predicted 1884
7 SASI_Hs01_00109838 predicted 1906
8 SASI_Hs01_00109839 predicted 820
9 SASI_Hs01_00109840 predicted 2048
10 SASI_Hs01_00109841 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00395356 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398743 predicted 1930
2 SASI_Hs02_00398744 predicted 2092
3 SASI_Hs02_00398745 predicted 924
4 SASI_Hs02_00398746 predicted 921
5 SASI_Hs02_00398747 predicted 1756
6 SASI_Hs02_00398748 predicted 1832
7 SASI_Hs02_00398749 predicted 2058
8 SASI_Hs02_00398750 predicted 1811
9 SASI_Hs02_00398751 predicted 950
10 SASI_Hs02_00398752 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419314 predicted 1700
2 SASI_Hs02_00419315 predicted 1865
3 SASI_Hs02_00419316 predicted 690
4 SASI_Hs02_00419317 predicted 695
5 SASI_Hs02_00419318 predicted 369
6 SASI_Hs02_00419319 predicted 1529
7 SASI_Hs02_00419320 predicted 1602
8 SASI_Hs02_00419321 predicted 1829
9 SASI_Hs02_00419322 predicted 1584
10 SASI_Hs02_00419323 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010914
ANKRD36C MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1844s1c1
Sequence:CCGGCCACAAGAATAACGGGCAGTTCTCGAGAACTGCCCGTTATTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-1297s1c1
Sequence:CCGGGCTACAAGTGACGAGAAAGATCTCGAGATCTTTCTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-798s1c1
Sequence:CCGGCGAGGAAGATTCTGTTTCGATCTCGAGATCGAAACAGAATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1897s1c1
Sequence:CCGGCCTACCTTGAAGGCTACAATTCTCGAGAATTGTAGCCTTCAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-827s1c1
Sequence:CCGGCAGAAATAAAGGACGGAGAAACTCGAGTTTCTCCGTCCTTTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2118s1c1
Sequence:CCGGGATAATCACTGTGAGCAACTTCTCGAGAAGTTGCTCACAGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-277s1c1
Sequence:CCGGGCTACAAGTGACGACAAAGATCTCGAGATCTTTGTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2124s1c1
Sequence:CCGGCACTGTGAGCAACTTAGAGTACTCGAGTACTCTAAGTTGCTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010914
ANKRD36C MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1844s1c1
Sequence:CCGGCCACAAGAATAACGGGCAGTTCTCGAGAACTGCCCGTTATTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-1297s1c1
Sequence:CCGGGCTACAAGTGACGAGAAAGATCTCGAGATCTTTCTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-798s1c1
Sequence:CCGGCGAGGAAGATTCTGTTTCGATCTCGAGATCGAAACAGAATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1897s1c1
Sequence:CCGGCCTACCTTGAAGGCTACAATTCTCGAGAATTGTAGCCTTCAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-827s1c1
Sequence:CCGGCAGAAATAAAGGACGGAGAAACTCGAGTTTCTCCGTCCTTTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2118s1c1
Sequence:CCGGGATAATCACTGTGAGCAACTTCTCGAGAAGTTGCTCACAGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-277s1c1
Sequence:CCGGGCTACAAGTGACGACAAAGATCTCGAGATCTTTGTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2124s1c1
Sequence:CCGGCACTGTGAGCAACTTAGAGTACTCGAGTACTCTAAGTTGCTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010914
ANKRD36C MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1844s1c1
Sequence:CCGGCCACAAGAATAACGGGCAGTTCTCGAGAACTGCCCGTTATTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-1297s1c1
Sequence:CCGGGCTACAAGTGACGAGAAAGATCTCGAGATCTTTCTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-798s1c1
Sequence:CCGGCGAGGAAGATTCTGTTTCGATCTCGAGATCGAAACAGAATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-1897s1c1
Sequence:CCGGCCTACCTTGAAGGCTACAATTCTCGAGAATTGTAGCCTTCAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010914.1-827s1c1
Sequence:CCGGCAGAAATAAAGGACGGAGAAACTCGAGTTTCTCCGTCCTTTATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2118s1c1
Sequence:CCGGGATAATCACTGTGAGCAACTTCTCGAGAAGTTGCTCACAGTGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010914.1-277s1c1
Sequence:CCGGGCTACAAGTGACGACAAAGATCTCGAGATCTTTGTCGTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010914.1-2124s1c1
Sequence:CCGGCACTGTGAGCAACTTAGAGTACTCGAGTACTCTAAGTTGCTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks