EMAIL THIS PAGE TO A FRIEND

ANKRD37

ankyrin repeat domain 37

62 Gene Product Result for
Synonyms: Lrp2bp
UniProtKB ID: Q7Z713
Gene ID:
Mouse(654824) ankyrin repeat domain 37
Rat(361149) ankyrin repeat domain 37
Zebrafish(793783) ankyrin repeat domain 37
cow(509139) ankyrin repeat domain 37
domestic cat(101092102) ankyrin repeat domain 37
dog(475627) ankyrin repeat domain 37
domestic guinea pig(100717184) ankyrin repeat domain 37
naked mole-rat(101708554) ankyrin repeat domain 37
Goat(100861074) ankyrin repeat domain 37
sheep(101112948) ankyrin repeat domain 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213611 MISSION® esiRNA esiRNA targeting mouse Ankrd37 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181726 Rosetta Predictions human pricing
NM_001108400 Rosetta Predictions rat pricing
NM_001039562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098002 predicted 660
2 SASI_Hs01_00098003 predicted 538
3 SASI_Hs01_00098005 predicted 430
4 SASI_Hs01_00098006 predicted 493
5 SASI_Hs02_00370338 predicted 258
6 SASI_Hs01_00098007 predicted 488
7 SASI_Hs01_00098008 predicted 632
8 SASI_Hs02_00370339 predicted 707
9 SASI_Hs01_00098009 predicted 471
10 SASI_Hs02_00370340 predicted 562
11 SASI_Hs01_00098004 predicted 566
12 SASI_Hs01_00098010 predicted 537
13 SASI_Hs01_00098011 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238289 predicted 352
2 SASI_Rn02_00238290 predicted 535
3 SASI_Rn02_00238291 predicted 323
4 SASI_Rn02_00238292 predicted 235
5 SASI_Rn02_00238293 predicted 218
6 SASI_Rn02_00238294 predicted 391
7 SASI_Rn02_00238295 predicted 269
8 SASI_Rn02_00238296 predicted 378
9 SASI_Rn02_00238297 predicted 518
10 SASI_Rn02_00238298 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135821 predicted 545
2 SASI_Mm01_00135822 predicted 400
3 SASI_Mm01_00135823 predicted 384
4 SASI_Mm01_00135824 predicted 360
5 SASI_Mm01_00135825 predicted 530
6 SASI_Mm01_00135826 predicted 463
7 SASI_Mm01_00135827 predicted 374
8 SASI_Mm01_00135828 predicted 590
9 SASI_Mm01_00135829 predicted 465
10 SASI_Mm02_00290158 predicted 457
11 SASI_Mm01_00135830 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181726
VALIDATED
ANKRD37 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 37
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-576s1c1
Sequence:CCGGGCCAAGTTTCTTACAACAATTCTCGAGAATTGTTGTAAGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-437s1c1
Sequence:CCGGTCCACTACACAAGGCAGCAAACTCGAGTTTGCTGCCTTGTGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-545s1c1
Sequence:CCGGTCTCGCTTGGTCATGTGGATTCTCGAGAATCCACATGACCAAGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-340s1c1
Sequence:CCGGCTGTCCACTTAGCCGCAGGAACTCGAGTTCCTGCGGCTAAGTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181726.1-629s1c1
Sequence:CCGGCCCTGACAGGAATGATTGTGTCTCGAGACACAATCATTCCTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-746s21c1
Sequence:CCGGACGCCTTCATTTCATGCAAATCTCGAGATTTGCATGAAATGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-555s21c1
Sequence:CCGGCATGTGGATTTCCAGACTGTGCTCGAGCACAGTCTGGAAATCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-476s21c1
Sequence:CCGGCTAAGCCTGCTTGTAGCCAGTCTCGAGACTGGCTACAAGCAGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-662s21c1
Sequence:CCGGCAGAAACGGAGTCTCGGAAGTCTCGAGACTTCCGAGACTCCGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-268s21c1
Sequence:CCGGGGATGGTCTGAAGCATTTGCTCTCGAGAGCAAATGCTTCAGACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-710s21c1
Sequence:CCGGTGCTGATGTCACGTGGGTTATCTCGAGATAACCCACGTGACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-646s21c1
Sequence:CCGGTGTTGCCGTGCTCAGACAGAACTCGAGTTCTGTCTGAGCACGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-723s21c1
Sequence:CCGGTGGGTTATGAAGAAGTCTGAACTCGAGTTCAGACTTCTTCATAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181726
VALIDATED
ANKRD37 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 37
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-576s1c1
Sequence:CCGGGCCAAGTTTCTTACAACAATTCTCGAGAATTGTTGTAAGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-437s1c1
Sequence:CCGGTCCACTACACAAGGCAGCAAACTCGAGTTTGCTGCCTTGTGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-545s1c1
Sequence:CCGGTCTCGCTTGGTCATGTGGATTCTCGAGAATCCACATGACCAAGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-340s1c1
Sequence:CCGGCTGTCCACTTAGCCGCAGGAACTCGAGTTCCTGCGGCTAAGTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181726.1-629s1c1
Sequence:CCGGCCCTGACAGGAATGATTGTGTCTCGAGACACAATCATTCCTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-746s21c1
Sequence:CCGGACGCCTTCATTTCATGCAAATCTCGAGATTTGCATGAAATGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-555s21c1
Sequence:CCGGCATGTGGATTTCCAGACTGTGCTCGAGCACAGTCTGGAAATCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-476s21c1
Sequence:CCGGCTAAGCCTGCTTGTAGCCAGTCTCGAGACTGGCTACAAGCAGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-662s21c1
Sequence:CCGGCAGAAACGGAGTCTCGGAAGTCTCGAGACTTCCGAGACTCCGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-268s21c1
Sequence:CCGGGGATGGTCTGAAGCATTTGCTCTCGAGAGCAAATGCTTCAGACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-710s21c1
Sequence:CCGGTGCTGATGTCACGTGGGTTATCTCGAGATAACCCACGTGACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-646s21c1
Sequence:CCGGTGTTGCCGTGCTCAGACAGAACTCGAGTTCTGTCTGAGCACGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-723s21c1
Sequence:CCGGTGGGTTATGAAGAAGTCTGAACTCGAGTTCAGACTTCTTCATAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181726
VALIDATED
ANKRD37 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 37
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-576s1c1
Sequence:CCGGGCCAAGTTTCTTACAACAATTCTCGAGAATTGTTGTAAGAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-437s1c1
Sequence:CCGGTCCACTACACAAGGCAGCAAACTCGAGTTTGCTGCCTTGTGTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-545s1c1
Sequence:CCGGTCTCGCTTGGTCATGTGGATTCTCGAGAATCCACATGACCAAGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181726.1-340s1c1
Sequence:CCGGCTGTCCACTTAGCCGCAGGAACTCGAGTTCCTGCGGCTAAGTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181726.1-629s1c1
Sequence:CCGGCCCTGACAGGAATGATTGTGTCTCGAGACACAATCATTCCTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-746s21c1
Sequence:CCGGACGCCTTCATTTCATGCAAATCTCGAGATTTGCATGAAATGAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-555s21c1
Sequence:CCGGCATGTGGATTTCCAGACTGTGCTCGAGCACAGTCTGGAAATCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-476s21c1
Sequence:CCGGCTAAGCCTGCTTGTAGCCAGTCTCGAGACTGGCTACAAGCAGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-662s21c1
Sequence:CCGGCAGAAACGGAGTCTCGGAAGTCTCGAGACTTCCGAGACTCCGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-268s21c1
Sequence:CCGGGGATGGTCTGAAGCATTTGCTCTCGAGAGCAAATGCTTCAGACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-710s21c1
Sequence:CCGGTGCTGATGTCACGTGGGTTATCTCGAGATAACCCACGTGACATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181726.2-646s21c1
Sequence:CCGGTGTTGCCGTGCTCAGACAGAACTCGAGTTCTGTCTGAGCACGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181726.2-723s21c1
Sequence:CCGGTGGGTTATGAAGAAGTCTGAACTCGAGTTCAGACTTCTTCATAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039562
ANKRD37 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 37
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-508s21c1
Sequence:CCGGGAAGATCTTGCTTGGTCATATCTCGAGATATGACCAAGCAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039562.1-731s21c1
Sequence:CCGGTCACTTCAGACAGATCTACAACTCGAGTTGTAGATCTGTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-628s21c1
Sequence:CCGGCTGAGACAGAAGCGGAGTTTCCTCGAGGAAACTCCGCTTCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-471s21c1
Sequence:CCGGCCAGATTGGCGTATGCAATAACTCGAGTTATTGCATACGCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-545s21c1
Sequence:CCGGCCAGGTTTCTAACAATGATTACTCGAGTAATCATTGTTAGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039562
ANKRD37 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 37
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-508s21c1
Sequence:CCGGGAAGATCTTGCTTGGTCATATCTCGAGATATGACCAAGCAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039562.1-731s21c1
Sequence:CCGGTCACTTCAGACAGATCTACAACTCGAGTTGTAGATCTGTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-628s21c1
Sequence:CCGGCTGAGACAGAAGCGGAGTTTCCTCGAGGAAACTCCGCTTCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-471s21c1
Sequence:CCGGCCAGATTGGCGTATGCAATAACTCGAGTTATTGCATACGCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-545s21c1
Sequence:CCGGCCAGGTTTCTAACAATGATTACTCGAGTAATCATTGTTAGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039562
ANKRD37 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 37
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-508s21c1
Sequence:CCGGGAAGATCTTGCTTGGTCATATCTCGAGATATGACCAAGCAAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039562.1-731s21c1
Sequence:CCGGTCACTTCAGACAGATCTACAACTCGAGTTGTAGATCTGTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-628s21c1
Sequence:CCGGCTGAGACAGAAGCGGAGTTTCCTCGAGGAAACTCCGCTTCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-471s21c1
Sequence:CCGGCCAGATTGGCGTATGCAATAACTCGAGTTATTGCATACGCCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039562.1-545s21c1
Sequence:CCGGCCAGGTTTCTAACAATGATTACTCGAGTAATCATTGTTAGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks