EMAIL THIS PAGE TO A FRIEND

ANKRD40

ankyrin repeat domain 40

112 Gene Product Result for
UniProtKB ID: Q6AI12, Q96E32
Gene ID:
Mouse(71452) ankyrin repeat domain 40
Rat(690586) ankyrin repeat domain 40
chicken(428678) ankyrin repeat domain 40
dog(491085) ankyrin repeat domain 40
cow(522429) ankyrin repeat domain 40
domestic cat(101089909) ankyrin repeat domain 40
domestic guinea pig(100727847) ankyrin repeat domain 40
naked mole-rat(101718962) ankyrin repeat domain 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052855 Rosetta Predictions human pricing
NM_001134699 Rosetta Predictions rat pricing
NM_027799 Rosetta Predictions mouse pricing
NM_146024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177757 predicted 1609
2 SASI_Hs02_00361550 predicted 1246
3 SASI_Hs01_00177758 predicted 778
4 SASI_Hs01_00177759 predicted 1299
5 SASI_Hs01_00177760 predicted 1346
6 SASI_Hs01_00177762 predicted 1640
7 SASI_Hs01_00177763 predicted 1549
8 SASI_Hs01_00177764 predicted 1378
9 SASI_Hs01_00177765 predicted 1039
10 SASI_Hs01_00177766 predicted 1581
11 SASI_Hs01_00177761 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258009 predicted 823
2 SASI_Rn02_00258010 predicted 1295
3 SASI_Rn02_00258011 predicted 463
4 SASI_Rn02_00258012 predicted 1307
5 SASI_Rn02_00258013 predicted 1198
6 SASI_Rn02_00258014 predicted 1116
7 SASI_Rn02_00258015 predicted 432
8 SASI_Rn02_00258016 predicted 1146
9 SASI_Rn02_00258017 predicted 982
10 SASI_Rn02_00258018 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332743 predicted 518
2 SASI_Mm01_00067305 predicted 881
3 SASI_Mm01_00067306 predicted 646
4 SASI_Mm01_00067307 predicted 484
5 SASI_Mm02_00332744 predicted 687
6 SASI_Mm01_00067308 predicted 553
7 SASI_Mm01_00067311 predicted 858
8 SASI_Mm01_00067313 predicted 783
9 SASI_Mm02_00332745 predicted 576
10 SASI_Mm02_00332746 predicted 647
11 SASI_Mm01_00067304 predicted 879
12 SASI_Mm01_00067309 predicted 1028
13 SASI_Mm01_00067310 predicted 1073
14 SASI_Mm01_00067312 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341593 predicted 515
2 SASI_Mm02_00341594 predicted 879
3 SASI_Mm02_00341595 predicted 653
4 SASI_Mm02_00341596 predicted 478
5 SASI_Mm02_00341597 predicted 691
6 SASI_Mm02_00341598 predicted 552
7 SASI_Mm02_00341599 predicted 854
8 SASI_Mm02_00341600 predicted 784
9 SASI_Mm02_00341601 predicted 578
10 SASI_Mm02_00341602 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027799
VALIDATED
ANKRD40 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-840s1c1
Sequence:CCGGCACCGGAGCATTTCCATTTAACTCGAGTTAAATGGAAATGCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-1169s1c1
Sequence:CCGGGCCAAAGGACAAGCCATTGATCTCGAGATCAATGGCTTGTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-677s1c1
Sequence:CCGGCCATACTTAGAACACCAGAAACTCGAGTTTCTGGTGTTCTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-842s1c1
Sequence:CCGGCCGGAGCATTTCCATTTAATACTCGAGTATTAAATGGAAATGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-243s1c1
Sequence:CCGGCTGTTTACACTGGGCATGTAACTCGAGTTACATGCCCAGTGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027799
VALIDATED
ANKRD40 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-840s1c1
Sequence:CCGGCACCGGAGCATTTCCATTTAACTCGAGTTAAATGGAAATGCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-1169s1c1
Sequence:CCGGGCCAAAGGACAAGCCATTGATCTCGAGATCAATGGCTTGTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-677s1c1
Sequence:CCGGCCATACTTAGAACACCAGAAACTCGAGTTTCTGGTGTTCTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-842s1c1
Sequence:CCGGCCGGAGCATTTCCATTTAATACTCGAGTATTAAATGGAAATGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-243s1c1
Sequence:CCGGCTGTTTACACTGGGCATGTAACTCGAGTTACATGCCCAGTGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027799
VALIDATED
ANKRD40 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-840s1c1
Sequence:CCGGCACCGGAGCATTTCCATTTAACTCGAGTTAAATGGAAATGCTCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-1169s1c1
Sequence:CCGGGCCAAAGGACAAGCCATTGATCTCGAGATCAATGGCTTGTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-677s1c1
Sequence:CCGGCCATACTTAGAACACCAGAAACTCGAGTTTCTGGTGTTCTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-842s1c1
Sequence:CCGGCCGGAGCATTTCCATTTAATACTCGAGTATTAAATGGAAATGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027799.1-243s1c1
Sequence:CCGGCTGTTTACACTGGGCATGTAACTCGAGTTACATGCCCAGTGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052855
VALIDATED
ANKRD40 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 40
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1605s1c1
Sequence:CCGGGCAGAAGCTGAAGGTTCTATACTCGAGTATAGAACCTTCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-794s1c1
Sequence:CCGGGCACTAGTTCAGAATGGTGATCTCGAGATCACCATTCTGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052855.2-587s1c1
Sequence:CCGGGAGTCAGAACTGCCCTTTGTTCTCGAGAACAAAGGGCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1142s1c1
Sequence:CCGGGAGCTGGGTGTTAATCCAGATCTCGAGATCTGGATTAACACCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1027s1c1
Sequence:CCGGGCTGGTACTCAAGGTGAGAATCTCGAGATTCTCACCTTGAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052855
VALIDATED
ANKRD40 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 40
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1605s1c1
Sequence:CCGGGCAGAAGCTGAAGGTTCTATACTCGAGTATAGAACCTTCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-794s1c1
Sequence:CCGGGCACTAGTTCAGAATGGTGATCTCGAGATCACCATTCTGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052855.2-587s1c1
Sequence:CCGGGAGTCAGAACTGCCCTTTGTTCTCGAGAACAAAGGGCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1142s1c1
Sequence:CCGGGAGCTGGGTGTTAATCCAGATCTCGAGATCTGGATTAACACCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1027s1c1
Sequence:CCGGGCTGGTACTCAAGGTGAGAATCTCGAGATTCTCACCTTGAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052855
VALIDATED
ANKRD40 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 40
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1605s1c1
Sequence:CCGGGCAGAAGCTGAAGGTTCTATACTCGAGTATAGAACCTTCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-794s1c1
Sequence:CCGGGCACTAGTTCAGAATGGTGATCTCGAGATCACCATTCTGAACTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052855.2-587s1c1
Sequence:CCGGGAGTCAGAACTGCCCTTTGTTCTCGAGAACAAAGGGCAGTTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1142s1c1
Sequence:CCGGGAGCTGGGTGTTAATCCAGATCTCGAGATCTGGATTAACACCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052855.2-1027s1c1
Sequence:CCGGGCTGGTACTCAAGGTGAGAATCTCGAGATTCTCACCTTGAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks