EMAIL THIS PAGE TO A FRIEND

ANKRD42

ankyrin repeat domain 42

75 Gene Product Result for
Synonyms: SARP
UniProtKB ID: Q8N9B4, Q49A49
Gene ID:
Mouse(73845) ankyrin repeat domain 42
Rat(293117) ankyrin repeat domain 42
naked mole-rat(101716141) ankyrin repeat domain 42
domestic guinea pig(100730723) ankyrin repeat domain 42
sheep(101106210) ankyrin repeat domain 42
Domestic Rabbit(100341748) ankyrin repeat domain 42
chicken(772327) ankyrin repeat domain 42
dog(100688339) ankyrin repeat domain 42
cow(522004) ankyrin repeat domain 42
domestic cat(101099243) ankyrin repeat domain 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41192 Anti-ANKRD42 antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, horse, canine, bovine, mouse, rat
western blot pricing
HPA039917 Anti-ANKRD42 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105445 Anti-ANKRD42, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182603 Rosetta Predictions human pricing
NM_001135013 Rosetta Predictions rat pricing
NM_028665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011971 predicted 1188
2 SASI_Hs01_00011972 predicted 1223
3 SASI_Hs01_00011973 predicted 1374
4 SASI_Hs01_00011974 predicted 1347
5 SASI_Hs01_00011975 predicted 1176
6 SASI_Hs01_00011976 predicted 683
7 SASI_Hs01_00011977 predicted 1384
8 SASI_Hs01_00011978 predicted 1242
9 SASI_Hs01_00011979 predicted 663
10 SASI_Hs02_00370739 predicted 1265
11 SASI_Hs01_00011980 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259450 predicted 1743
2 SASI_Rn02_00259451 predicted 1859
3 SASI_Rn02_00259452 predicted 2074
4 SASI_Rn02_00259453 predicted 1648
5 SASI_Rn02_00259454 predicted 2117
6 SASI_Rn02_00259455 predicted 924
7 SASI_Rn02_00259456 predicted 1872
8 SASI_Rn02_00259457 predicted 1939
9 SASI_Rn02_00259458 predicted 1748
10 SASI_Rn02_00259459 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066087 predicted 1269
2 SASI_Mm01_00066088 predicted 1722
3 SASI_Mm01_00066089 predicted 1430
4 SASI_Mm01_00066090 predicted 1821
5 SASI_Mm02_00334205 predicted 1974
6 SASI_Mm01_00066091 predicted 1882
7 SASI_Mm02_00334206 predicted 2098
8 SASI_Mm01_00066093 predicted 1874
9 SASI_Mm01_00066096 predicted 1812
10 SASI_Mm02_00334207 predicted 1305
11 SASI_Mm01_00066092 predicted 1929
12 SASI_Mm01_00066094 predicted 1897
13 SASI_Mm01_00066095 predicted 1790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182603
ANKRD42 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 42
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-850s1c1
Sequence:CCGGCTAGAGGATCAGGAAACTTTACTCGAGTAAAGTTTCCTGATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-1129s1c1
Sequence:CCGGGAGGAGCTACAGAAATATGATCTCGAGATCATATTTCTGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-521s21c1
Sequence:CCGGAGTACGAGCTGGAGATGTAAACTCGAGTTTACATCTCCAGCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182603.2-2210s21c1
Sequence:CCGGACCTCAAATCTGATCTATTAACTCGAGTTAATAGATCAGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-656s21c1
Sequence:CCGGTGCTTGTGTACAGGCTCTTATCTCGAGATAAGAGCCTGTACACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-1296s21c1
Sequence:CCGGATGGGAGCAGACAGTAATATTCTCGAGAATATTACTGTCTGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-788s21c1
Sequence:CCGGGGATCCCAGTGTGACTGATAACTCGAGTTATCAGTCACACTGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182603
ANKRD42 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 42
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-850s1c1
Sequence:CCGGCTAGAGGATCAGGAAACTTTACTCGAGTAAAGTTTCCTGATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-1129s1c1
Sequence:CCGGGAGGAGCTACAGAAATATGATCTCGAGATCATATTTCTGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-521s21c1
Sequence:CCGGAGTACGAGCTGGAGATGTAAACTCGAGTTTACATCTCCAGCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182603.2-2210s21c1
Sequence:CCGGACCTCAAATCTGATCTATTAACTCGAGTTAATAGATCAGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-656s21c1
Sequence:CCGGTGCTTGTGTACAGGCTCTTATCTCGAGATAAGAGCCTGTACACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-1296s21c1
Sequence:CCGGATGGGAGCAGACAGTAATATTCTCGAGAATATTACTGTCTGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-788s21c1
Sequence:CCGGGGATCCCAGTGTGACTGATAACTCGAGTTATCAGTCACACTGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182603
ANKRD42 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 42
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-850s1c1
Sequence:CCGGCTAGAGGATCAGGAAACTTTACTCGAGTAAAGTTTCCTGATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182603.1-1129s1c1
Sequence:CCGGGAGGAGCTACAGAAATATGATCTCGAGATCATATTTCTGTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-521s21c1
Sequence:CCGGAGTACGAGCTGGAGATGTAAACTCGAGTTTACATCTCCAGCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182603.2-2210s21c1
Sequence:CCGGACCTCAAATCTGATCTATTAACTCGAGTTAATAGATCAGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-656s21c1
Sequence:CCGGTGCTTGTGTACAGGCTCTTATCTCGAGATAAGAGCCTGTACACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-1296s21c1
Sequence:CCGGATGGGAGCAGACAGTAATATTCTCGAGAATATTACTGTCTGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182603.2-788s21c1
Sequence:CCGGGGATCCCAGTGTGACTGATAACTCGAGTTATCAGTCACACTGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028665
ANKRD42 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 42
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1457s1c1
Sequence:CCGGGCCACCTCCATTGTTTGAAATCTCGAGATTTCAAACAATGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1198s1c1
Sequence:CCGGGCCAACCTAGCAACTCAAGATCTCGAGATCTTGAGTTGCTAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028665.1-2881s1c1
Sequence:CCGGCCCAACAACTACTTAACTTATCTCGAGATAAGTTAAGTAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1519s1c1
Sequence:CCGGGCCTTCAATGATAATGGAGAACTCGAGTTCTCCATTATCATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1621s1c1
Sequence:CCGGCCAGATGATCATGATGATTTACTCGAGTAAATCATCATGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-1094s21c1
Sequence:CCGGGAGCGTGGTGCCAACCTTAATCTCGAGATTAAGGTTGGCACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2506s21c1
Sequence:CCGGATCAGTGCAGTAAGGTTAAATCTCGAGATTTAACCTTACTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2224s21c1
Sequence:CCGGGATAACCGAAGAGGATTTAAACTCGAGTTTAAATCCTCTTCGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028665
ANKRD42 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 42
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1457s1c1
Sequence:CCGGGCCACCTCCATTGTTTGAAATCTCGAGATTTCAAACAATGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1198s1c1
Sequence:CCGGGCCAACCTAGCAACTCAAGATCTCGAGATCTTGAGTTGCTAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028665.1-2881s1c1
Sequence:CCGGCCCAACAACTACTTAACTTATCTCGAGATAAGTTAAGTAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1519s1c1
Sequence:CCGGGCCTTCAATGATAATGGAGAACTCGAGTTCTCCATTATCATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1621s1c1
Sequence:CCGGCCAGATGATCATGATGATTTACTCGAGTAAATCATCATGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-1094s21c1
Sequence:CCGGGAGCGTGGTGCCAACCTTAATCTCGAGATTAAGGTTGGCACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2506s21c1
Sequence:CCGGATCAGTGCAGTAAGGTTAAATCTCGAGATTTAACCTTACTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2224s21c1
Sequence:CCGGGATAACCGAAGAGGATTTAAACTCGAGTTTAAATCCTCTTCGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028665
ANKRD42 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 42
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1457s1c1
Sequence:CCGGGCCACCTCCATTGTTTGAAATCTCGAGATTTCAAACAATGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1198s1c1
Sequence:CCGGGCCAACCTAGCAACTCAAGATCTCGAGATCTTGAGTTGCTAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028665.1-2881s1c1
Sequence:CCGGCCCAACAACTACTTAACTTATCTCGAGATAAGTTAAGTAGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1519s1c1
Sequence:CCGGGCCTTCAATGATAATGGAGAACTCGAGTTCTCCATTATCATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028665.1-1621s1c1
Sequence:CCGGCCAGATGATCATGATGATTTACTCGAGTAAATCATCATGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-1094s21c1
Sequence:CCGGGAGCGTGGTGCCAACCTTAATCTCGAGATTAAGGTTGGCACCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2506s21c1
Sequence:CCGGATCAGTGCAGTAAGGTTAAATCTCGAGATTTAACCTTACTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028665.4-2224s21c1
Sequence:CCGGGATAACCGAAGAGGATTTAAACTCGAGTTTAAATCCTCTTCGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks