EMAIL THIS PAGE TO A FRIEND

ANKRD44

ankyrin repeat domain 44

197 Gene Product Result for
Synonyms: PP6-ARS-B
UniProtKB ID: Q8N8A2, Q53SL9, Q6P480, Q86VL5, Q8IZ72, Q9UFA4
Gene ID:
Mouse(329154) ankyrin repeat domain 44
Rat(301415) ankyrin repeat domain 44
Zebrafish(561373) ankyrin repeat domain 44
chicken(424055) ankyrin repeat domain 44
cow(526800) ankyrin repeat domain 44
Horse(100070473) ankyrin repeat domain 44
domestic cat(101083440) ankyrin repeat domain 44
dog(478852) ankyrin repeat domain 44
sheep(101121070) ankyrin repeat domain 44
Domestic Rabbit(100340911) ankyrin repeat domain 44
domestic guinea pig(100723787) ankyrin repeat domain 44
naked mole-rat(101707847) ankyrin repeat domain 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153697 Rosetta Predictions human pricing
XM_001066455 Rosetta Predictions rat pricing
XM_237153 Rosetta Predictions rat pricing
NM_001081433 Rosetta Predictions mouse pricing
XM_900427 Rosetta Predictions mouse pricing
XM_900434 Rosetta Predictions mouse pricing
XM_900439 Rosetta Predictions mouse pricing
XM_900454 Rosetta Predictions mouse pricing
XM_900460 Rosetta Predictions mouse pricing
XM_993465 Rosetta Predictions mouse pricing
XM_993490 Rosetta Predictions mouse pricing
XM_993510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367410 predicted 1383
2 SASI_Hs01_00039795 predicted 634
3 SASI_Hs01_00039796 predicted 2167
4 SASI_Hs01_00039797 predicted 1947
5 SASI_Hs01_00039798 predicted 437
6 SASI_Hs01_00039800 predicted 1243
7 SASI_Hs02_00367411 predicted 1564
8 SASI_Hs01_00039801 predicted 594
9 SASI_Hs02_00367412 predicted 1681
10 SASI_Hs01_00039802 predicted 2584
11 SASI_Hs01_00039799 predicted 1720
12 SASI_Hs01_00039803 predicted 1338
13 SASI_Hs01_00039804 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317504 predicted 2729
2 SASI_Rn02_00317505 predicted 837
3 SASI_Rn02_00317506 predicted 1716
4 SASI_Rn02_00317507 predicted 829
5 SASI_Rn02_00317508 predicted 642
6 SASI_Rn02_00317509 predicted 2977
7 SASI_Rn02_00317510 predicted 530
8 SASI_Rn02_00317511 predicted 2627
9 SASI_Rn02_00317512 predicted 2468
10 SASI_Rn02_00317513 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390677 predicted 2722
2 SASI_Rn02_00390678 predicted 839
3 SASI_Rn02_00390679 predicted 1713
4 SASI_Rn02_00390680 predicted 824
5 SASI_Rn02_00390681 predicted 638
6 SASI_Rn02_00390682 predicted 2970
7 SASI_Rn02_00390683 predicted 537
8 SASI_Rn02_00390684 predicted 2623
9 SASI_Rn02_00390685 predicted 2468
10 SASI_Rn02_00390686 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298331 predicted 1388
2 SASI_Mm02_00298332 predicted 2832
3 SASI_Mm02_00298333 predicted 2326
4 SASI_Mm02_00298334 predicted 1681
5 SASI_Mm02_00298335 predicted 633
6 SASI_Mm02_00298336 predicted 3023
7 SASI_Mm02_00298337 predicted 843
8 SASI_Mm02_00298338 predicted 2867
9 SASI_Mm02_00298339 predicted 3001
10 SASI_Mm02_00298340 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248670 predicted 661
2 SASI_Mm01_00248671 predicted 1168
3 SASI_Mm01_00248672 predicted 1115
4 SASI_Mm01_00248673 predicted 590
5 SASI_Mm01_00248674 predicted 1128
6 SASI_Mm01_00248675 predicted 877
7 SASI_Mm01_00248676 predicted 1017
8 SASI_Mm01_00248677 predicted 1049
9 SASI_Mm01_00248678 predicted 677
10 SASI_Mm01_00248679 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284983 predicted 637
2 SASI_Mm01_00284984 predicted 1396
3 SASI_Mm01_00284985 predicted 564
4 SASI_Mm01_00284986 predicted 843
5 SASI_Mm01_00284987 predicted 1432
6 SASI_Mm01_00284988 predicted 987
7 SASI_Mm01_00284989 predicted 1018
8 SASI_Mm01_00284990 predicted 639
9 SASI_Mm01_00284991 predicted 767
10 SASI_Mm01_00284992 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272731 predicted 423
2 SASI_Mm01_00272732 predicted 607
3 SASI_Mm01_00272733 predicted 806
4 SASI_Mm01_00272734 predicted 516
5 SASI_Mm01_00272735 predicted 416
6 SASI_Mm01_00272736 predicted 799
7 SASI_Mm01_00272737 predicted 779
8 SASI_Mm01_00272738 predicted 648
9 SASI_Mm01_00272739 predicted 772
10 SASI_Mm01_00272740 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215403 predicted 349
2 SASI_Mm01_00215404 predicted 354
3 SASI_Mm01_00215405 predicted 357
4 SASI_Mm01_00215406 predicted 310
5 SASI_Mm01_00215407 predicted 395
6 SASI_Mm01_00215408 predicted 364
7 SASI_Mm01_00215409 predicted 270
8 SASI_Mm01_00215410 predicted 215
9 SASI_Mm01_00215411 predicted 362
10 SASI_Mm01_00215412 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268693 predicted 2783
2 SASI_Mm01_00268694 predicted 2273
3 SASI_Mm01_00268695 predicted 1900
4 SASI_Mm01_00268696 predicted 2979
5 SASI_Mm01_00268697 predicted 3254
6 SASI_Mm01_00268698 predicted 848
7 SASI_Mm01_00268699 predicted 2819
8 SASI_Mm01_00268700 predicted 2946
9 SASI_Mm01_00268701 predicted 1024
10 SASI_Mm01_00268702 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219767 predicted 1162
2 SASI_Mm01_00219768 predicted 2609
3 SASI_Mm01_00219769 predicted 2105
4 SASI_Mm01_00219770 predicted 3009
5 SASI_Mm01_00219771 predicted 1740
6 SASI_Mm01_00219772 predicted 2810
7 SASI_Mm01_00219773 predicted 624
8 SASI_Mm01_00219774 predicted 2644
9 SASI_Mm01_00219775 predicted 2776
10 SASI_Mm01_00219776 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218420 predicted 2785
2 SASI_Mm01_00218421 predicted 2278
3 SASI_Mm01_00218422 predicted 1628
4 SASI_Mm01_00218423 predicted 3186
5 SASI_Mm01_00218424 predicted 1906
6 SASI_Mm01_00218425 predicted 2977
7 SASI_Mm01_00218426 predicted 849
8 SASI_Mm01_00218427 predicted 2814
9 SASI_Mm01_00218428 predicted 2946
10 SASI_Mm01_00218429 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238338 predicted 1390
2 SASI_Mm01_00238339 predicted 2839
3 SASI_Mm01_00238340 predicted 2328
4 SASI_Mm01_00238341 predicted 3232
5 SASI_Mm01_00238342 predicted 1957
6 SASI_Mm01_00238343 predicted 3027
7 SASI_Mm01_00238344 predicted 851
8 SASI_Mm01_00238345 predicted 2865
9 SASI_Mm01_00238346 predicted 3005
10 SASI_Mm01_00238347 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153697
ANKRD44 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 44
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1328s21c1
Sequence:CCGGGCACTATGCAGCTGCGAATTGCTCGAGCAATTCGCAGCTGCATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1841s21c1
Sequence:CCGGAGAATGTGTGGAAGCGCTTATCTCGAGATAAGCGCTTCCACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2790s21c1
Sequence:CCGGCAAGACGAGAGCCTTATTAATCTCGAGATTAATAAGGCTCTCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2831s21c1
Sequence:CCGGGACGTAAGTGTAACTACTAAACTCGAGTTTAGTAGTTACACTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153697.1-800s1c1
Sequence:CCGGCCAGCCAAACAATAATGGGTTCTCGAGAACCCATTATTGTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-165s1c1
Sequence:CCGGGAGATCATTGAACTCCTGATTCTCGAGAATCAGGAGTTCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-2031s1c1
Sequence:CCGGGCAGTAGCATATGGACATATTCTCGAGAATATGTCCATATGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-1126s1c1
Sequence:CCGGCTTTACATTTAGCTGCCCTAACTCGAGTTAGGGCAGCTAAATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153697.1-3288s1c1
Sequence:CCGGCCTTGGTGTGAAAGATCTAAACTCGAGTTTAGATCTTTCACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153697
ANKRD44 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 44
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1328s21c1
Sequence:CCGGGCACTATGCAGCTGCGAATTGCTCGAGCAATTCGCAGCTGCATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1841s21c1
Sequence:CCGGAGAATGTGTGGAAGCGCTTATCTCGAGATAAGCGCTTCCACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2790s21c1
Sequence:CCGGCAAGACGAGAGCCTTATTAATCTCGAGATTAATAAGGCTCTCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2831s21c1
Sequence:CCGGGACGTAAGTGTAACTACTAAACTCGAGTTTAGTAGTTACACTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153697.1-800s1c1
Sequence:CCGGCCAGCCAAACAATAATGGGTTCTCGAGAACCCATTATTGTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-165s1c1
Sequence:CCGGGAGATCATTGAACTCCTGATTCTCGAGAATCAGGAGTTCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-2031s1c1
Sequence:CCGGGCAGTAGCATATGGACATATTCTCGAGAATATGTCCATATGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-1126s1c1
Sequence:CCGGCTTTACATTTAGCTGCCCTAACTCGAGTTAGGGCAGCTAAATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153697.1-3288s1c1
Sequence:CCGGCCTTGGTGTGAAAGATCTAAACTCGAGTTTAGATCTTTCACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153697
ANKRD44 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 44
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1328s21c1
Sequence:CCGGGCACTATGCAGCTGCGAATTGCTCGAGCAATTCGCAGCTGCATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-1841s21c1
Sequence:CCGGAGAATGTGTGGAAGCGCTTATCTCGAGATAAGCGCTTCCACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2790s21c1
Sequence:CCGGCAAGACGAGAGCCTTATTAATCTCGAGATTAATAAGGCTCTCGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153697.1-2831s21c1
Sequence:CCGGGACGTAAGTGTAACTACTAAACTCGAGTTTAGTAGTTACACTTACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153697.1-800s1c1
Sequence:CCGGCCAGCCAAACAATAATGGGTTCTCGAGAACCCATTATTGTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-165s1c1
Sequence:CCGGGAGATCATTGAACTCCTGATTCTCGAGAATCAGGAGTTCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-2031s1c1
Sequence:CCGGGCAGTAGCATATGGACATATTCTCGAGAATATGTCCATATGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153697.1-1126s1c1
Sequence:CCGGCTTTACATTTAGCTGCCCTAACTCGAGTTAGGGCAGCTAAATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153697.1-3288s1c1
Sequence:CCGGCCTTGGTGTGAAAGATCTAAACTCGAGTTTAGATCTTTCACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081433
ANKRD44 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081433.1-5162s21c1
Sequence:CCGGATTGCCTAAAGTCCTAGTAAACTCGAGTTTACTAGGACTTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-646s21c1
Sequence:CCGGCACATGGAGATGGTCAATTTACTCGAGTAAATTGACCATCTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-1621s21c1
Sequence:CCGGACCACCGGAGCCAACGTTAATCTCGAGATTAACGTTGGCTCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-375s21c1
Sequence:CCGGTTTGTCAGGAGCTCGTGTAAACTCGAGTTTACACGAGCTCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-2330s21c1
Sequence:CCGGACGTAGATGCGGTCGACATAGCTCGAGCTATGTCGACCGCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081433
ANKRD44 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081433.1-5162s21c1
Sequence:CCGGATTGCCTAAAGTCCTAGTAAACTCGAGTTTACTAGGACTTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-646s21c1
Sequence:CCGGCACATGGAGATGGTCAATTTACTCGAGTAAATTGACCATCTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-1621s21c1
Sequence:CCGGACCACCGGAGCCAACGTTAATCTCGAGATTAACGTTGGCTCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-375s21c1
Sequence:CCGGTTTGTCAGGAGCTCGTGTAAACTCGAGTTTACACGAGCTCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-2330s21c1
Sequence:CCGGACGTAGATGCGGTCGACATAGCTCGAGCTATGTCGACCGCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081433
ANKRD44 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081433.1-5162s21c1
Sequence:CCGGATTGCCTAAAGTCCTAGTAAACTCGAGTTTACTAGGACTTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-646s21c1
Sequence:CCGGCACATGGAGATGGTCAATTTACTCGAGTAAATTGACCATCTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-1621s21c1
Sequence:CCGGACCACCGGAGCCAACGTTAATCTCGAGATTAACGTTGGCTCCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-375s21c1
Sequence:CCGGTTTGTCAGGAGCTCGTGTAAACTCGAGTTTACACGAGCTCCTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081433.1-2330s21c1
Sequence:CCGGACGTAGATGCGGTCGACATAGCTCGAGCTATGTCGACCGCATCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks