EMAIL THIS PAGE TO A FRIEND

ANKRD45

ankyrin repeat domain 45

111 Gene Product Result for
Synonyms: CT117 RP3-436N22.4
UniProtKB ID: Q5TZF3, A1A4G2, Q6ZST1
Gene ID:
Mouse(73844) ankyrin repeat domain 45
Rat(289152) ankyrin repeat domain 45
Zebrafish(553808) ankyrin repeat domain 45
dog(611232) ankyrin repeat domain 45
cow(100336740) ankyrin repeat domain 45
domestic cat(101093234) ankyrin repeat domain 45
naked mole-rat(101726539) ankyrin repeat domain 45
domestic guinea pig(100731312) ankyrin repeat domain 45
sheep(101116848) ankyrin repeat domain 45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198493 Rosetta Predictions human pricing
XM_001074114 Rosetta Predictions rat pricing
XM_213908 Rosetta Predictions rat pricing
XM_355251 Rosetta Predictions mouse pricing
XM_924833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036326 predicted 553
2 SASI_Hs01_00036327 predicted 478
3 SASI_Hs02_00372062 predicted 737
4 SASI_Hs02_00372063 predicted 840
5 SASI_Hs01_00036328 predicted 692
6 SASI_Hs01_00036329 predicted 901
7 SASI_Hs01_00036330 predicted 742
8 SASI_Hs01_00036331 predicted 683
9 SASI_Hs01_00036333 predicted 810
10 SASI_Hs01_00036334 predicted 739
11 SASI_Hs01_00036332 predicted 507
12 SASI_Hs01_00036335 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345072 predicted 820
2 SASI_Rn02_00345073 predicted 335
3 SASI_Rn02_00345074 predicted 339
4 SASI_Rn02_00345075 predicted 268
5 SASI_Rn02_00345076 predicted 716
6 SASI_Rn02_00345077 predicted 765
7 SASI_Rn02_00345078 predicted 460
8 SASI_Rn02_00345079 predicted 295
9 SASI_Rn02_00345080 predicted 697
10 SASI_Rn02_00345081 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374996 predicted 819
2 SASI_Rn02_00374997 predicted 332
3 SASI_Rn02_00374998 predicted 337
4 SASI_Rn02_00374999 predicted 268
5 SASI_Rn02_00375000 predicted 712
6 SASI_Rn02_00375001 predicted 766
7 SASI_Rn02_00375002 predicted 462
8 SASI_Rn02_00375003 predicted 296
9 SASI_Rn02_00375004 predicted 697
10 SASI_Rn02_00375005 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219175 predicted 446
2 SASI_Mm01_00219176 predicted 387
3 SASI_Mm01_00219177 predicted 401
4 SASI_Mm01_00219178 predicted 478
5 SASI_Mm01_00219179 predicted 400
6 SASI_Mm01_00219181 predicted 396
7 SASI_Mm01_00219182 predicted 400
8 SASI_Mm01_00219183 predicted 448
9 SASI_Mm01_00219184 predicted 407
10 SASI_Mm02_00425822 predicted 489
11 SASI_Mm01_00219180 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444347 predicted 498
2 SASI_Mm02_00444348 predicted 557
3 SASI_Mm02_00444349 predicted 623
4 SASI_Mm02_00444350 predicted 614
5 SASI_Mm02_00444351 predicted 641
6 SASI_Mm02_00444352 predicted 403
7 SASI_Mm02_00444353 predicted 478
8 SASI_Mm02_00444354 predicted 612
9 SASI_Mm02_00444355 predicted 618
10 SASI_Mm02_00444356 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198493
ANKRD45 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 45
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-501s1c1
Sequence:CCGGGAGATGTTGCTGCTAGATATTCTCGAGAATATCTAGCAGCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-230s1c1
Sequence:CCGGGATCCTGAGAATCCTCATCATCTCGAGATGATGAGGATTCTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-387s1c1
Sequence:CCGGGAGGGTACACACTCTTACATTCTCGAGAATGTAAGAGTGTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198493.1-1910s1c1
Sequence:CCGGGCAATAACTTTCAGCCACCTTCTCGAGAAGGTGGCTGAAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-781s1c1
Sequence:CCGGGACTACACCATGTCAAGTGAACTCGAGTTCACTTGACATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-699s1c1
Sequence:CCGGCCCATACAGAAGCTTCCATTACTCGAGTAATGGAAGCTTCTGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1138s21c1
Sequence:CCGGACTACTCAGAGAATCTAATAACTCGAGTTATTAGATTCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198493.2-500s21c1
Sequence:CCGGCGAGATGTTGCTGCTAGATATCTCGAGATATCTAGCAGCAACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1085s21c1
Sequence:CCGGAGGAAAGCACTTGGGTATAAACTCGAGTTTATACCCAAGTGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198493
ANKRD45 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 45
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-501s1c1
Sequence:CCGGGAGATGTTGCTGCTAGATATTCTCGAGAATATCTAGCAGCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-230s1c1
Sequence:CCGGGATCCTGAGAATCCTCATCATCTCGAGATGATGAGGATTCTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-387s1c1
Sequence:CCGGGAGGGTACACACTCTTACATTCTCGAGAATGTAAGAGTGTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198493.1-1910s1c1
Sequence:CCGGGCAATAACTTTCAGCCACCTTCTCGAGAAGGTGGCTGAAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-781s1c1
Sequence:CCGGGACTACACCATGTCAAGTGAACTCGAGTTCACTTGACATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-699s1c1
Sequence:CCGGCCCATACAGAAGCTTCCATTACTCGAGTAATGGAAGCTTCTGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1138s21c1
Sequence:CCGGACTACTCAGAGAATCTAATAACTCGAGTTATTAGATTCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198493.2-500s21c1
Sequence:CCGGCGAGATGTTGCTGCTAGATATCTCGAGATATCTAGCAGCAACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1085s21c1
Sequence:CCGGAGGAAAGCACTTGGGTATAAACTCGAGTTTATACCCAAGTGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198493
ANKRD45 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 45
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-501s1c1
Sequence:CCGGGAGATGTTGCTGCTAGATATTCTCGAGAATATCTAGCAGCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-230s1c1
Sequence:CCGGGATCCTGAGAATCCTCATCATCTCGAGATGATGAGGATTCTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-387s1c1
Sequence:CCGGGAGGGTACACACTCTTACATTCTCGAGAATGTAAGAGTGTGTACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198493.1-1910s1c1
Sequence:CCGGGCAATAACTTTCAGCCACCTTCTCGAGAAGGTGGCTGAAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198493.1-781s1c1
Sequence:CCGGGACTACACCATGTCAAGTGAACTCGAGTTCACTTGACATGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198493.1-699s1c1
Sequence:CCGGCCCATACAGAAGCTTCCATTACTCGAGTAATGGAAGCTTCTGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1138s21c1
Sequence:CCGGACTACTCAGAGAATCTAATAACTCGAGTTATTAGATTCTCTGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198493.2-500s21c1
Sequence:CCGGCGAGATGTTGCTGCTAGATATCTCGAGATATCTAGCAGCAACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198493.2-1085s21c1
Sequence:CCGGAGGAAAGCACTTGGGTATAAACTCGAGTTTATACCCAAGTGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355251
ANKRD45 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-620s21c1
Sequence:CCGGGGGATGTTGCTGCTCGTTATTCTCGAGAATAACGAGCAGCAACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-707s21c1
Sequence:CCGGCAAAGTCCTCCCTCATCATTACTCGAGTAATGATGAGGGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-458s21c1
Sequence:GTACCGGTTAAAGCCTTGGCAAAGTATGCTCGAGCATACTTTGCCAAGGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-642s21c1
Sequence:CCGGTCAGGTTGAATGTGTTAATTTCTCGAGAAATTAACACATTCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-141s21c1
Sequence:CCGGTGGGCGTCATCCAAGGTATTTCTCGAGAAATACCTTGGATGACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355251
ANKRD45 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-620s21c1
Sequence:CCGGGGGATGTTGCTGCTCGTTATTCTCGAGAATAACGAGCAGCAACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-707s21c1
Sequence:CCGGCAAAGTCCTCCCTCATCATTACTCGAGTAATGATGAGGGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-458s21c1
Sequence:GTACCGGTTAAAGCCTTGGCAAAGTATGCTCGAGCATACTTTGCCAAGGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-642s21c1
Sequence:CCGGTCAGGTTGAATGTGTTAATTTCTCGAGAAATTAACACATTCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-141s21c1
Sequence:CCGGTGGGCGTCATCCAAGGTATTTCTCGAGAAATACCTTGGATGACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355251
ANKRD45 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-620s21c1
Sequence:CCGGGGGATGTTGCTGCTCGTTATTCTCGAGAATAACGAGCAGCAACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-707s21c1
Sequence:CCGGCAAAGTCCTCCCTCATCATTACTCGAGTAATGATGAGGGAGGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-458s21c1
Sequence:GTACCGGTTAAAGCCTTGGCAAAGTATGCTCGAGCATACTTTGCCAAGGCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-642s21c1
Sequence:CCGGTCAGGTTGAATGTGTTAATTTCTCGAGAAATTAACACATTCAACCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355251.5-141s21c1
Sequence:CCGGTGGGCGTCATCCAAGGTATTTCTCGAGAAATACCTTGGATGACGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks