EMAIL THIS PAGE TO A FRIEND

ANKRD46

ankyrin repeat domain 46

185 Gene Product Result for
Synonyms: ANK-S GENX-115279
UniProtKB ID: Q86W74, Q6P9B7
Gene ID:
Human(157567) Summary: This gene encodes a protein containing multiple ankyrin repeats. Ankyrin domains function in protein-protein interactions in a variety of cellular processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(68839) ankyrin repeat domain 46
Rat(299982) ankyrin repeat domain 46
sheep(101103486) ankyrin repeat domain 46
domestic guinea pig(100729423) ankyrin repeat domain 46
naked mole-rat(101719841) ankyrin repeat domain 46
chicken(426304) ankyrin repeat domain 46
cow(534898) ankyrin repeat domain 46
domestic cat(101097619) ankyrin repeat domain 46
dog(475050) ankyrin repeat domain 46
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062431 MISSION® esiRNA esiRNA human ANKRD46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198401 Rosetta Predictions human pricing
NM_001013948 Rosetta Predictions rat pricing
NM_175134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225394 predicted 726
2 SASI_Hs01_00225395 predicted 560
3 SASI_Hs01_00225396 predicted 887
4 SASI_Hs01_00225397 predicted 977
5 SASI_Hs01_00225398 predicted 925
6 SASI_Hs01_00225399 predicted 756
7 SASI_Hs01_00225400 predicted 1141
8 SASI_Hs01_00225401 predicted 997
9 SASI_Hs01_00225403 predicted 648
10 SASI_Hs02_00371925 predicted 562
11 SASI_Hs01_00225402 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063033 predicted 301
2 SASI_Rn01_00063034 predicted 820
3 SASI_Rn01_00063035 predicted 220
4 SASI_Rn01_00063036 predicted 744
5 SASI_Rn01_00063037 predicted 658
6 SASI_Rn02_00201259 predicted 779
7 SASI_Rn01_00063039 predicted 956
8 SASI_Rn01_00063041 predicted 371
9 SASI_Rn01_00063042 predicted 608
10 SASI_Rn02_00201260 predicted 234
11 SASI_Rn01_00063038 predicted 409
12 SASI_Rn01_00063040 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345757 predicted 1261
2 SASI_Mm01_00079116 predicted 259
3 SASI_Mm02_00345758 predicted 967
4 SASI_Mm01_00079117 predicted 414
5 SASI_Mm01_00079118 predicted 929
6 SASI_Mm01_00079119 predicted 433
7 SASI_Mm01_00079120 predicted 1066
8 SASI_Mm01_00079121 predicted 1085
9 SASI_Mm01_00079122 predicted 694
10 SASI_Mm01_00079123 predicted 1029
11 SASI_Mm01_00079115 predicted 1273
12 SASI_Mm01_00079124 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198401
ANKRD46 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 46
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-652s21c1
Sequence:CCGGGCAAAGCGCAGAGGAGTAAATCTCGAGATTTACTCCTCTGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-406s21c1
Sequence:CCGGGAAAGTGGCTTTGACCCAAATCTCGAGATTTGGGTCAAAGCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198401.2-1005s21c1
Sequence:CCGGATGGAAGATGAGGCAATTAATCTCGAGATTAATTGCCTCATCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-613s1c1
Sequence:CCGGCGAAACTGGAGACCATGCAAACTCGAGTTTGCATGGTCTCCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-645s1c1
Sequence:CCGGGAAAGTGCCATGGAAAGCCATCTCGAGATGGCTTTCCATGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-657s1c1
Sequence:CCGGGAAAGCCATTCACTCCTCAATCTCGAGATTGAGGAGTGAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-752s1c1
Sequence:CCGGCTTCTGGAGAGTATTGCTGTTCTCGAGAACAGCAATACTCTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-396s1c1
Sequence:CCGGGCCACAGATTATCAAGGAAACCTCGAGGTTTCCTTGATAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198401
ANKRD46 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 46
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-652s21c1
Sequence:CCGGGCAAAGCGCAGAGGAGTAAATCTCGAGATTTACTCCTCTGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-406s21c1
Sequence:CCGGGAAAGTGGCTTTGACCCAAATCTCGAGATTTGGGTCAAAGCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198401.2-1005s21c1
Sequence:CCGGATGGAAGATGAGGCAATTAATCTCGAGATTAATTGCCTCATCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-613s1c1
Sequence:CCGGCGAAACTGGAGACCATGCAAACTCGAGTTTGCATGGTCTCCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-645s1c1
Sequence:CCGGGAAAGTGCCATGGAAAGCCATCTCGAGATGGCTTTCCATGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-657s1c1
Sequence:CCGGGAAAGCCATTCACTCCTCAATCTCGAGATTGAGGAGTGAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-752s1c1
Sequence:CCGGCTTCTGGAGAGTATTGCTGTTCTCGAGAACAGCAATACTCTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-396s1c1
Sequence:CCGGGCCACAGATTATCAAGGAAACCTCGAGGTTTCCTTGATAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198401
ANKRD46 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 46
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-652s21c1
Sequence:CCGGGCAAAGCGCAGAGGAGTAAATCTCGAGATTTACTCCTCTGCGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198401.2-406s21c1
Sequence:CCGGGAAAGTGGCTTTGACCCAAATCTCGAGATTTGGGTCAAAGCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198401.2-1005s21c1
Sequence:CCGGATGGAAGATGAGGCAATTAATCTCGAGATTAATTGCCTCATCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-613s1c1
Sequence:CCGGCGAAACTGGAGACCATGCAAACTCGAGTTTGCATGGTCTCCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-645s1c1
Sequence:CCGGGAAAGTGCCATGGAAAGCCATCTCGAGATGGCTTTCCATGGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-657s1c1
Sequence:CCGGGAAAGCCATTCACTCCTCAATCTCGAGATTGAGGAGTGAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-752s1c1
Sequence:CCGGCTTCTGGAGAGTATTGCTGTTCTCGAGAACAGCAATACTCTCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198401.1-396s1c1
Sequence:CCGGGCCACAGATTATCAAGGAAACCTCGAGGTTTCCTTGATAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175134
VALIDATED
ANKRD46 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 46
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-564s1c1
Sequence:CCGGCAGGAAGTAAAGGGATTTAACCTCGAGGTTAAATCCCTTTACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-755s1c1
Sequence:CCGGGTTGATCTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-1581s21c1
Sequence:CCGGCTTTGTAGTGAATAGTCATTACTCGAGTAATGACTATTCACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-537s21c1
Sequence:CCGGATCCGACTGCTGGAGTCTTTGCTCGAGCAAAGACTCCAGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-342s21c1
Sequence:CCGGATCTGCCAGCTGCTGCATAAGCTCGAGCTTATGCAGCAGCTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-810s21c1
Sequence:CCGGGTGTTGCCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-427s21c1
Sequence:CCGGTGGACACCATTCAGTTCTTAGCTCGAGCTAAGAACTGAATGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175134.2-1892s1c1
Sequence:CCGGCCCTCTTTGCTTCTGTGGTATCTCGAGATACCACAGAAGCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175134
VALIDATED
ANKRD46 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 46
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-564s1c1
Sequence:CCGGCAGGAAGTAAAGGGATTTAACCTCGAGGTTAAATCCCTTTACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-755s1c1
Sequence:CCGGGTTGATCTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-1581s21c1
Sequence:CCGGCTTTGTAGTGAATAGTCATTACTCGAGTAATGACTATTCACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-537s21c1
Sequence:CCGGATCCGACTGCTGGAGTCTTTGCTCGAGCAAAGACTCCAGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-342s21c1
Sequence:CCGGATCTGCCAGCTGCTGCATAAGCTCGAGCTTATGCAGCAGCTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-810s21c1
Sequence:CCGGGTGTTGCCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-427s21c1
Sequence:CCGGTGGACACCATTCAGTTCTTAGCTCGAGCTAAGAACTGAATGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175134.2-1892s1c1
Sequence:CCGGCCCTCTTTGCTTCTGTGGTATCTCGAGATACCACAGAAGCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175134
VALIDATED
ANKRD46 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 46
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-564s1c1
Sequence:CCGGCAGGAAGTAAAGGGATTTAACCTCGAGGTTAAATCCCTTTACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175134.3-755s1c1
Sequence:CCGGGTTGATCTTGGTCATTGCTTTCTCGAGAAAGCAATGACCAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-1581s21c1
Sequence:CCGGCTTTGTAGTGAATAGTCATTACTCGAGTAATGACTATTCACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-537s21c1
Sequence:CCGGATCCGACTGCTGGAGTCTTTGCTCGAGCAAAGACTCCAGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-342s21c1
Sequence:CCGGATCTGCCAGCTGCTGCATAAGCTCGAGCTTATGCAGCAGCTGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_175134.3-810s21c1
Sequence:CCGGGTGTTGCCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175134.3-427s21c1
Sequence:CCGGTGGACACCATTCAGTTCTTAGCTCGAGCTAAGAACTGAATGGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175134.2-1892s1c1
Sequence:CCGGCCCTCTTTGCTTCTGTGGTATCTCGAGATACCACAGAAGCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks