EMAIL THIS PAGE TO A FRIEND

ANKRD49

ankyrin repeat domain 49

149 Gene Product Result for
Synonyms: FGIF GBIF
UniProtKB ID: Q8WVL7, Q8NDF2, Q96JE5, Q9NXK7
Gene ID:
Mouse(56503) ankyrin repeat domain 49
Rat(315434) ankyrin repeat domain 49
Zebrafish(550246) ankyrin repeat domain 49
dog(485125) ankyrin repeat domain 49
domestic cat(101086673) ankyrin repeat domain 49
cow(540949) ankyrin repeat domain 49
chicken(418997) ankyrin repeat domain 49
naked mole-rat(101709563) ankyrin repeat domain 49
domestic guinea pig(100713092) ankyrin repeat domain 49
sheep(101115060) ankyrin repeat domain 49
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110891 MISSION® esiRNA esiRNA human ANKRD49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017704 Rosetta Predictions human pricing
NM_001126283 Rosetta Predictions rat pricing
NM_019683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199116 predicted 843
2 SASI_Hs01_00199117 predicted 707
3 SASI_Hs01_00199118 predicted 903
4 SASI_Hs01_00199119 predicted 853
5 SASI_Hs01_00199120 predicted 796
6 SASI_Hs01_00199121 predicted 626
7 SASI_Hs01_00199123 predicted 1023
8 SASI_Hs01_00199125 predicted 621
9 SASI_Hs02_00350461 predicted 753
10 SASI_Hs02_00350462 predicted 605
11 SASI_Hs01_00199122 predicted 759
12 SASI_Hs01_00199124 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253203 predicted 321
2 SASI_Rn02_00253204 predicted 562
3 SASI_Rn02_00253205 predicted 736
4 SASI_Rn02_00253206 predicted 832
5 SASI_Rn02_00253207 predicted 910
6 SASI_Rn02_00253208 predicted 616
7 SASI_Rn02_00253209 predicted 925
8 SASI_Rn02_00253210 predicted 835
9 SASI_Rn02_00253211 predicted 934
10 SASI_Rn02_00253212 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136780 predicted 800
2 SASI_Mm01_00136781 predicted 797
3 SASI_Mm01_00136782 predicted 975
4 SASI_Mm01_00136783 predicted 578
5 SASI_Mm01_00136784 predicted 713
6 SASI_Mm01_00136785 predicted 748
7 SASI_Mm01_00136786 predicted 897
8 SASI_Mm01_00136787 predicted 955
9 SASI_Mm01_00136788 predicted 525
10 SASI_Mm01_00136789 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017704
VALIDATED
ANKRD49 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 49
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-178s1c1
Sequence:CCGGCCAAGAGAATTCCTTGGATTTCTCGAGAAATCCAAGGAATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-447s1c1
Sequence:CCGGCTAGGGATGAAGATGAGTATACTCGAGTATACTCATCTTCATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017704.2-721s1c1
Sequence:CCGGCCTGATGAACCGTTACGTCAACTCGAGTTGACGTAACGGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-579s1c1
Sequence:CCGGGTGCTTGTAAGTGGAATAATACTCGAGTATTATTCCACTTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-203s1c1
Sequence:CCGGGAACACTTTAACCAACTTGAACTCGAGTTCAAGTTGGTTAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-247s21c1
Sequence:CCGGTATTCCTACTGGTACTCAAAGCTCGAGCTTTGAGTACCAGTAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017704.2-1189s21c1
Sequence:CCGGTGGATCTTTGTTGGGTATTTACTCGAGTAAATACCCAACAAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-844s21c1
Sequence:CCGGTTCACCTCAGTCTTAACAATTCTCGAGAATTGTTAAGACTGAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-723s21c1
Sequence:CCGGTGATGAACCGTTACGTCAAACCTCGAGGTTTGACGTAACGGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-448s21c1
Sequence:CCGGTAGGGATGAAGATGAGTATACCTCGAGGTATACTCATCTTCATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017704
VALIDATED
ANKRD49 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 49
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-178s1c1
Sequence:CCGGCCAAGAGAATTCCTTGGATTTCTCGAGAAATCCAAGGAATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-447s1c1
Sequence:CCGGCTAGGGATGAAGATGAGTATACTCGAGTATACTCATCTTCATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017704.2-721s1c1
Sequence:CCGGCCTGATGAACCGTTACGTCAACTCGAGTTGACGTAACGGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-579s1c1
Sequence:CCGGGTGCTTGTAAGTGGAATAATACTCGAGTATTATTCCACTTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-203s1c1
Sequence:CCGGGAACACTTTAACCAACTTGAACTCGAGTTCAAGTTGGTTAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-247s21c1
Sequence:CCGGTATTCCTACTGGTACTCAAAGCTCGAGCTTTGAGTACCAGTAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017704.2-1189s21c1
Sequence:CCGGTGGATCTTTGTTGGGTATTTACTCGAGTAAATACCCAACAAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-844s21c1
Sequence:CCGGTTCACCTCAGTCTTAACAATTCTCGAGAATTGTTAAGACTGAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-723s21c1
Sequence:CCGGTGATGAACCGTTACGTCAAACCTCGAGGTTTGACGTAACGGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-448s21c1
Sequence:CCGGTAGGGATGAAGATGAGTATACCTCGAGGTATACTCATCTTCATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017704
VALIDATED
ANKRD49 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 49
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-178s1c1
Sequence:CCGGCCAAGAGAATTCCTTGGATTTCTCGAGAAATCCAAGGAATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-447s1c1
Sequence:CCGGCTAGGGATGAAGATGAGTATACTCGAGTATACTCATCTTCATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017704.2-721s1c1
Sequence:CCGGCCTGATGAACCGTTACGTCAACTCGAGTTGACGTAACGGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-579s1c1
Sequence:CCGGGTGCTTGTAAGTGGAATAATACTCGAGTATTATTCCACTTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017704.2-203s1c1
Sequence:CCGGGAACACTTTAACCAACTTGAACTCGAGTTCAAGTTGGTTAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-247s21c1
Sequence:CCGGTATTCCTACTGGTACTCAAAGCTCGAGCTTTGAGTACCAGTAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017704.2-1189s21c1
Sequence:CCGGTGGATCTTTGTTGGGTATTTACTCGAGTAAATACCCAACAAAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-844s21c1
Sequence:CCGGTTCACCTCAGTCTTAACAATTCTCGAGAATTGTTAAGACTGAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-723s21c1
Sequence:CCGGTGATGAACCGTTACGTCAAACCTCGAGGTTTGACGTAACGGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017704.2-448s21c1
Sequence:CCGGTAGGGATGAAGATGAGTATACCTCGAGGTATACTCATCTTCATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019683
VALIDATED
ANKRD49 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 49
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-1119s1c1
Sequence:CCGGCCTGGGTCTTTGTTCAGTTTACTCGAGTAAACTGAACAAAGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-563s1c1
Sequence:CCGGGCCTCTTTCTTACTTCAGCATCTCGAGATGCTGAAGTAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-676s1c1
Sequence:CCGGCCTGATGAATCGTTACATCAACTCGAGTTGATGTAACGATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-364s1c1
Sequence:CCGGGCAGAGACTACTCTCTGAGAACTCGAGTTCTCAGAGAGTAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-677s1c1
Sequence:CCGGCTGATGAATCGTTACATCAAACTCGAGTTTGATGTAACGATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-159s21c1
Sequence:GTACCGGCAGTTTAACCAGCTTGAATTGCTCGAGCAATTCAAGCTGGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-1555s21c1
Sequence:CCGGTGGATTAGGCATTACTCATAACTCGAGTTATGAGTAATGCCTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-805s21c1
Sequence:CCGGCGTCTTAATGACTCTAGTAATCTCGAGATTACTAGAGTCATTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-436s21c1
Sequence:CCGGCAGCCTACAGTGGGCATATAGCTCGAGCTATATGCCCACTGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-217s21c1
Sequence:CCGGAGAGTCTCTGGGTAGGCAATTCTCGAGAATTGCCTACCCAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019683
VALIDATED
ANKRD49 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 49
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-1119s1c1
Sequence:CCGGCCTGGGTCTTTGTTCAGTTTACTCGAGTAAACTGAACAAAGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-563s1c1
Sequence:CCGGGCCTCTTTCTTACTTCAGCATCTCGAGATGCTGAAGTAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-676s1c1
Sequence:CCGGCCTGATGAATCGTTACATCAACTCGAGTTGATGTAACGATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-364s1c1
Sequence:CCGGGCAGAGACTACTCTCTGAGAACTCGAGTTCTCAGAGAGTAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-677s1c1
Sequence:CCGGCTGATGAATCGTTACATCAAACTCGAGTTTGATGTAACGATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-159s21c1
Sequence:GTACCGGCAGTTTAACCAGCTTGAATTGCTCGAGCAATTCAAGCTGGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-1555s21c1
Sequence:CCGGTGGATTAGGCATTACTCATAACTCGAGTTATGAGTAATGCCTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-805s21c1
Sequence:CCGGCGTCTTAATGACTCTAGTAATCTCGAGATTACTAGAGTCATTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-436s21c1
Sequence:CCGGCAGCCTACAGTGGGCATATAGCTCGAGCTATATGCCCACTGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-217s21c1
Sequence:CCGGAGAGTCTCTGGGTAGGCAATTCTCGAGAATTGCCTACCCAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019683
VALIDATED
ANKRD49 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 49
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-1119s1c1
Sequence:CCGGCCTGGGTCTTTGTTCAGTTTACTCGAGTAAACTGAACAAAGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019683.2-563s1c1
Sequence:CCGGGCCTCTTTCTTACTTCAGCATCTCGAGATGCTGAAGTAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-676s1c1
Sequence:CCGGCCTGATGAATCGTTACATCAACTCGAGTTGATGTAACGATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-364s1c1
Sequence:CCGGGCAGAGACTACTCTCTGAGAACTCGAGTTCTCAGAGAGTAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019683.2-677s1c1
Sequence:CCGGCTGATGAATCGTTACATCAAACTCGAGTTTGATGTAACGATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-159s21c1
Sequence:GTACCGGCAGTTTAACCAGCTTGAATTGCTCGAGCAATTCAAGCTGGTTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-1555s21c1
Sequence:CCGGTGGATTAGGCATTACTCATAACTCGAGTTATGAGTAATGCCTAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019683.3-805s21c1
Sequence:CCGGCGTCTTAATGACTCTAGTAATCTCGAGATTACTAGAGTCATTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-436s21c1
Sequence:CCGGCAGCCTACAGTGGGCATATAGCTCGAGCTATATGCCCACTGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019683.3-217s21c1
Sequence:CCGGAGAGTCTCTGGGTAGGCAATTCTCGAGAATTGCCTACCCAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks