EMAIL THIS PAGE TO A FRIEND

ANKRD50

ankyrin repeat domain 50

109 Gene Product Result for
UniProtKB ID: Q9ULJ7, A8K4V3, B4DHJ6, E9PDW0, Q6N064, Q6ZSE6
Gene ID:
Mouse(99696) ankyrin repeat domain 50
Rat(294988) ankyrin repeat domain 50
chicken(422663) ankyrin repeat domain 50
dog(483835) ankyrin repeat domain 50
cow(527956) ankyrin repeat domain 50
Horse(100063702) ankyrin repeat domain 50
domestic cat(101084790) ankyrin repeat domain 50
sheep(101123497) ankyrin repeat domain 50
Domestic Rabbit(100358187) ankyrin repeat domain 50
domestic guinea pig(100717866) ankyrin repeat domain 50
naked mole-rat(101725828) ankyrin repeat domain 50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044008 Anti-ANKRD50 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107267 Anti-ANKRD50 antibody produced in rabbit affinity isolated antibody horse, rat, guinea pig, human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020337 Rosetta Predictions human pricing
XM_001069855 Rosetta Predictions rat pricing
XM_215553 Rosetta Predictions rat pricing
NM_001033198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154301 predicted 2527
2 SASI_Hs01_00154302 predicted 1348
3 SASI_Hs01_00154304 predicted 309
4 SASI_Hs01_00154305 predicted 1063
5 SASI_Hs01_00154306 predicted 3569
6 SASI_Hs01_00154307 predicted 2025
7 SASI_Hs01_00154308 predicted 820
8 SASI_Hs01_00154310 predicted 2616
9 SASI_Hs02_00353263 predicted 405
10 SASI_Hs02_00353264 predicted 874
11 SASI_Hs01_00154303 predicted 4050
12 SASI_Hs01_00154309 predicted 3042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329597 predicted 1359
2 SASI_Rn02_00329598 predicted 3944
3 SASI_Rn02_00329599 predicted 3210
4 SASI_Rn02_00329600 predicted 1606
5 SASI_Rn02_00329601 predicted 2843
6 SASI_Rn02_00329602 predicted 1523
7 SASI_Rn02_00329603 predicted 3727
8 SASI_Rn02_00329604 predicted 1798
9 SASI_Rn02_00329605 predicted 1585
10 SASI_Rn02_00329606 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376075 predicted 1350
2 SASI_Rn02_00376076 predicted 1572
3 SASI_Rn02_00376077 predicted 3202
4 SASI_Rn02_00376078 predicted 2310
5 SASI_Rn02_00376079 predicted 1605
6 SASI_Rn02_00376080 predicted 2840
7 SASI_Rn02_00376081 predicted 1525
8 SASI_Rn02_00376082 predicted 1801
9 SASI_Rn02_00376083 predicted 1577
10 SASI_Rn02_00376084 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024156 predicted 1713
2 SASI_Mm02_00288314 predicted 845
3 SASI_Mm01_00024157 predicted 435
4 SASI_Mm01_00024158 predicted 1499
5 SASI_Mm01_00024159 predicted 217
6 SASI_Mm01_00024160 predicted 1628
7 SASI_Mm02_00288315 predicted 848
8 SASI_Mm01_00024163 predicted 1115
9 SASI_Mm01_00024164 predicted 1644
10 SASI_Mm01_00024165 predicted 1073
11 SASI_Mm01_00024161 predicted 1107
12 SASI_Mm01_00024162 predicted 1728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020337
ANKRD50 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-1804s21c1
Sequence:CCGGGACCTTCGGAAGGCATATATCCTCGAGGATATATGCCTTCCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-4212s21c1
Sequence:CCGGTGATGTTGTTCAGGTCTTATTCTCGAGAATAAGACCTGAACAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1366s1c1
Sequence:CCGGCGGAATTATATCACGCAGTATCTCGAGATACTGCGTGATATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5007s1c1
Sequence:CCGGGCCTGTTTCTTGTATCTTTAACTCGAGTTAAAGATACAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-2913s1c1
Sequence:CCGGCCTTTCATATTAGCTTCACAACTCGAGTTGTGAAGCTAATATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5458s1c1
Sequence:CCGGCCCTGAATAATTCATTGACTACTCGAGTAGTCAATGAATTATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1068s1c1
Sequence:CCGGCAGTACATTCTTCATCGTTTACTCGAGTAAACGATGAAGAATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-414s1c1
Sequence:CCGGGCACCATCACTTGTAATGAATCTCGAGATTCATTACAAGTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-6681s1c1
Sequence:CCGGGCGAAGATATGACATTGCATACTCGAGTATGCAATGTCATATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020337
ANKRD50 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-1804s21c1
Sequence:CCGGGACCTTCGGAAGGCATATATCCTCGAGGATATATGCCTTCCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-4212s21c1
Sequence:CCGGTGATGTTGTTCAGGTCTTATTCTCGAGAATAAGACCTGAACAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1366s1c1
Sequence:CCGGCGGAATTATATCACGCAGTATCTCGAGATACTGCGTGATATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5007s1c1
Sequence:CCGGGCCTGTTTCTTGTATCTTTAACTCGAGTTAAAGATACAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-2913s1c1
Sequence:CCGGCCTTTCATATTAGCTTCACAACTCGAGTTGTGAAGCTAATATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5458s1c1
Sequence:CCGGCCCTGAATAATTCATTGACTACTCGAGTAGTCAATGAATTATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1068s1c1
Sequence:CCGGCAGTACATTCTTCATCGTTTACTCGAGTAAACGATGAAGAATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-414s1c1
Sequence:CCGGGCACCATCACTTGTAATGAATCTCGAGATTCATTACAAGTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-6681s1c1
Sequence:CCGGGCGAAGATATGACATTGCATACTCGAGTATGCAATGTCATATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020337
ANKRD50 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-1804s21c1
Sequence:CCGGGACCTTCGGAAGGCATATATCCTCGAGGATATATGCCTTCCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020337.2-4212s21c1
Sequence:CCGGTGATGTTGTTCAGGTCTTATTCTCGAGAATAAGACCTGAACAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1366s1c1
Sequence:CCGGCGGAATTATATCACGCAGTATCTCGAGATACTGCGTGATATAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5007s1c1
Sequence:CCGGGCCTGTTTCTTGTATCTTTAACTCGAGTTAAAGATACAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-2913s1c1
Sequence:CCGGCCTTTCATATTAGCTTCACAACTCGAGTTGTGAAGCTAATATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-5458s1c1
Sequence:CCGGCCCTGAATAATTCATTGACTACTCGAGTAGTCAATGAATTATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-1068s1c1
Sequence:CCGGCAGTACATTCTTCATCGTTTACTCGAGTAAACGATGAAGAATGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020337.1-414s1c1
Sequence:CCGGGCACCATCACTTGTAATGAATCTCGAGATTCATTACAAGTGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020337.1-6681s1c1
Sequence:CCGGGCGAAGATATGACATTGCATACTCGAGTATGCAATGTCATATCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033198
VALIDATED
ANKRD50 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 50
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-493s21c1
Sequence:CCGGACGGGCATTCTCAGATCATTACTCGAGTAATGATCTGAGAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-441s21c1
Sequence:CCGGCCCAATCATGCCGACCAATTTCTCGAGAAATTGGTCGGCATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033198.2-953s21c1
Sequence:CCGGCTTAGGACACAGCCATAATTCCTCGAGGAATTATGGCTGTGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-206s21c1
Sequence:CCGGGGAGATGGTGCGGGTACTTATCTCGAGATAAGTACCCGCACCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-1701s21c1
Sequence:CCGGGTCTCCACCACACCGAATAAACTCGAGTTTATTCGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033198
VALIDATED
ANKRD50 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 50
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-493s21c1
Sequence:CCGGACGGGCATTCTCAGATCATTACTCGAGTAATGATCTGAGAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-441s21c1
Sequence:CCGGCCCAATCATGCCGACCAATTTCTCGAGAAATTGGTCGGCATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033198.2-953s21c1
Sequence:CCGGCTTAGGACACAGCCATAATTCCTCGAGGAATTATGGCTGTGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-206s21c1
Sequence:CCGGGGAGATGGTGCGGGTACTTATCTCGAGATAAGTACCCGCACCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-1701s21c1
Sequence:CCGGGTCTCCACCACACCGAATAAACTCGAGTTTATTCGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033198
VALIDATED
ANKRD50 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 50
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-493s21c1
Sequence:CCGGACGGGCATTCTCAGATCATTACTCGAGTAATGATCTGAGAATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-441s21c1
Sequence:CCGGCCCAATCATGCCGACCAATTTCTCGAGAAATTGGTCGGCATGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033198.2-953s21c1
Sequence:CCGGCTTAGGACACAGCCATAATTCCTCGAGGAATTATGGCTGTGTCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-206s21c1
Sequence:CCGGGGAGATGGTGCGGGTACTTATCTCGAGATAAGTACCCGCACCATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033198.2-1701s21c1
Sequence:CCGGGTCTCCACCACACCGAATAAACTCGAGTTTATTCGGTGTGGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks