EMAIL THIS PAGE TO A FRIEND

ANKRD52

ankyrin repeat domain 52

Synonyms: ANKRD33
UniProtKB ID: Q8NB46, A6NE79, B1Q2K2
Gene ID:
Mouse(237615) ankyrin repeat domain 52
Rat(362811) ankyrin repeat domain 52
naked mole-rat(101711247) ankyrin repeat domain 52
domestic guinea pig(100734004) ankyrin repeat domain 52
sheep(101109431) ankyrin repeat domain 52
Domestic Rabbit(100350556) ankyrin repeat domain 52
chicken(426469) ankyrin repeat domain 52
dog(481109) ankyrin repeat domain 52
cow(521057) ankyrin repeat domain 52
Horse(100059440) ankyrin repeat domain 52
domestic cat(101085903) ankyrin repeat domain 52
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173595 Rosetta Predictions human pricing
XM_001070685 Rosetta Predictions rat pricing
XM_343139 Rosetta Predictions rat pricing
NM_172790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368435 predicted 1774
2 SASI_Hs02_00368436 predicted 1465
3 SASI_Hs02_00368437 predicted 579
4 SASI_Hs02_00368438 predicted 1212
5 SASI_Hs02_00368439 predicted 2318
6 SASI_Hs02_00368440 predicted 2937
7 SASI_Hs02_00368441 predicted 1348
8 SASI_Hs02_00368442 predicted 2123
9 SASI_Hs02_00368443 predicted 1850
10 SASI_Hs02_00368444 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332450 predicted 2820
2 SASI_Rn02_00332451 predicted 1486
3 SASI_Rn02_00332452 predicted 1735
4 SASI_Rn02_00332453 predicted 1782
5 SASI_Rn02_00332454 predicted 3438
6 SASI_Rn02_00332455 predicted 2860
7 SASI_Rn02_00332456 predicted 1310
8 SASI_Rn02_00332457 predicted 2419
9 SASI_Rn02_00332458 predicted 680
10 SASI_Rn02_00332459 predicted 3039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395373 predicted 2821
2 SASI_Rn02_00395374 predicted 1481
3 SASI_Rn02_00395375 predicted 1734
4 SASI_Rn02_00395376 predicted 1779
5 SASI_Rn02_00395377 predicted 3444
6 SASI_Rn02_00395378 predicted 2861
7 SASI_Rn02_00395379 predicted 1309
8 SASI_Rn02_00395380 predicted 2417
9 SASI_Rn02_00395381 predicted 677
10 SASI_Rn02_00395382 predicted 3040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056725 predicted 276
2 SASI_Mm02_00344690 predicted 1220
3 SASI_Mm01_00056727 predicted 2780
4 SASI_Mm01_00056728 predicted 1651
5 SASI_Mm02_00344691 predicted 822
6 SASI_Mm01_00056729 predicted 2332
7 SASI_Mm01_00056730 predicted 1485
8 SASI_Mm01_00056731 predicted 1695
9 SASI_Mm01_00056732 predicted 589
10 SASI_Mm01_00056734 predicted 1799
11 SASI_Mm01_00056726 predicted 1401
12 SASI_Mm01_00056733 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172790
ANKRD52 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 52
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172790.1-4231s1c1
Sequence:CCGGCCCTAGTATATGTCCTGTGTTCTCGAGAACACAGGACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-2575s1c1
Sequence:CCGGCCTTTGCACTGTGCAGTAATTCTCGAGAATTACTGCACAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1397s1c1
Sequence:CCGGGAGGAAATGTTGAATGTCTTACTCGAGTAAGACATTCAACATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1696s1c1
Sequence:CCGGCTGGAGTTCTTATTGGATAATCTCGAGATTATCCAATAAGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-693s1c1
Sequence:CCGGCCTCAGCTGTAAAGATCGAAACTCGAGTTTCGATCTTTACAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-592s21c1
Sequence:CCGGAGCCTGAATGTCTGCGATAAACTCGAGTTTATCGCAGACATTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-2445s21c1
Sequence:CCGGCCTAGATGCTGGTGTCGATTACTCGAGTAATCGACACCAGCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172790
ANKRD52 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 52
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172790.1-4231s1c1
Sequence:CCGGCCCTAGTATATGTCCTGTGTTCTCGAGAACACAGGACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-2575s1c1
Sequence:CCGGCCTTTGCACTGTGCAGTAATTCTCGAGAATTACTGCACAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1397s1c1
Sequence:CCGGGAGGAAATGTTGAATGTCTTACTCGAGTAAGACATTCAACATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1696s1c1
Sequence:CCGGCTGGAGTTCTTATTGGATAATCTCGAGATTATCCAATAAGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-693s1c1
Sequence:CCGGCCTCAGCTGTAAAGATCGAAACTCGAGTTTCGATCTTTACAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-592s21c1
Sequence:CCGGAGCCTGAATGTCTGCGATAAACTCGAGTTTATCGCAGACATTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-2445s21c1
Sequence:CCGGCCTAGATGCTGGTGTCGATTACTCGAGTAATCGACACCAGCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172790
ANKRD52 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 52
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172790.1-4231s1c1
Sequence:CCGGCCCTAGTATATGTCCTGTGTTCTCGAGAACACAGGACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-2575s1c1
Sequence:CCGGCCTTTGCACTGTGCAGTAATTCTCGAGAATTACTGCACAGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1397s1c1
Sequence:CCGGGAGGAAATGTTGAATGTCTTACTCGAGTAAGACATTCAACATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-1696s1c1
Sequence:CCGGCTGGAGTTCTTATTGGATAATCTCGAGATTATCCAATAAGAACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172790.1-693s1c1
Sequence:CCGGCCTCAGCTGTAAAGATCGAAACTCGAGTTTCGATCTTTACAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-592s21c1
Sequence:CCGGAGCCTGAATGTCTGCGATAAACTCGAGTTTATCGCAGACATTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172790.2-2445s21c1
Sequence:CCGGCCTAGATGCTGGTGTCGATTACTCGAGTAATCGACACCAGCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173595
VALIDATED
ANKRD52 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 52
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1117s21c1
Sequence:CCGGCTGCATGTGGCTGCTCGATATCTCGAGATATCGAGCAGCCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-3344s21c1
Sequence:CCGGGCCGGTGGCTTGATATCTAATCTCGAGATTAGATATCAAGCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1495s21c1
Sequence:CCGGTACCAGTGTGCAGTAACATTGCTCGAGCAATGTTACTGCACACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1082s21c1
Sequence:CCGGAGATTGATTGTGCCGACAAATCTCGAGATTTGTCGGCACAATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-952s21c1
Sequence:CCGGTGCTTGGAGCTACTGGTTAATCTCGAGATTAACCAGTAGCTCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173595
VALIDATED
ANKRD52 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 52
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1117s21c1
Sequence:CCGGCTGCATGTGGCTGCTCGATATCTCGAGATATCGAGCAGCCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-3344s21c1
Sequence:CCGGGCCGGTGGCTTGATATCTAATCTCGAGATTAGATATCAAGCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1495s21c1
Sequence:CCGGTACCAGTGTGCAGTAACATTGCTCGAGCAATGTTACTGCACACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1082s21c1
Sequence:CCGGAGATTGATTGTGCCGACAAATCTCGAGATTTGTCGGCACAATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-952s21c1
Sequence:CCGGTGCTTGGAGCTACTGGTTAATCTCGAGATTAACCAGTAGCTCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173595
VALIDATED
ANKRD52 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 52
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1117s21c1
Sequence:CCGGCTGCATGTGGCTGCTCGATATCTCGAGATATCGAGCAGCCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-3344s21c1
Sequence:CCGGGCCGGTGGCTTGATATCTAATCTCGAGATTAGATATCAAGCCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1495s21c1
Sequence:CCGGTACCAGTGTGCAGTAACATTGCTCGAGCAATGTTACTGCACACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-1082s21c1
Sequence:CCGGAGATTGATTGTGCCGACAAATCTCGAGATTTGTCGGCACAATCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_173595.3-952s21c1
Sequence:CCGGTGCTTGGAGCTACTGGTTAATCTCGAGATTAACCAGTAGCTCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks