EMAIL THIS PAGE TO A FRIEND

ANKRD53

ankyrin repeat domain 53

99 Gene Product Result for
UniProtKB ID: Q8N9V6, Q8IYP8
Gene ID:
Mouse(75305) ankyrin repeat domain 53
cow(789483) ankyrin repeat domain 53
domestic cat(101096387) ankyrin repeat domain 53
dog(474629) ankyrin repeat domain 53
sheep(101102636) ankyrin repeat domain 53
domestic guinea pig(100716909) ankyrin repeat domain 53
naked mole-rat(101723003) ankyrin repeat domain 53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169241 MISSION® esiRNA esiRNA targeting mouse Ankrd53 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115116 Rosetta Predictions human pricing
NM_024933 Rosetta Predictions human pricing
NM_029245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326956 predicted 1330
2 SASI_Hs02_00326957 predicted 1576
3 SASI_Hs02_00326958 predicted 1687
4 SASI_Hs02_00326959 predicted 1693
5 SASI_Hs02_00326960 predicted 1351
6 SASI_Hs02_00326961 predicted 1693
7 SASI_Hs02_00326962 predicted 1693
8 SASI_Hs02_00326963 predicted 1710
9 SASI_Hs02_00326964 predicted 1579
10 SASI_Hs02_00326965 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357557 predicted 1460
2 SASI_Hs02_00357558 predicted 1703
3 SASI_Hs02_00357559 predicted 1477
4 SASI_Hs02_00357560 predicted 1708
5 SASI_Hs02_00357561 predicted 383
6 SASI_Hs02_00357562 predicted 1704
7 SASI_Hs01_00140882 predicted 922
8 SASI_Hs02_00357563 predicted 310
9 SASI_Hs01_00140884 predicted 1020
10 SASI_Hs01_00140887 predicted 1240
11 SASI_Hs01_00140881 predicted 1091
12 SASI_Hs01_00140883 predicted 1477
13 SASI_Hs01_00140885 predicted 1178
14 SASI_Hs01_00140886 predicted 1465
15 SASI_Hs01_00140888 predicted 1155
16 SASI_Hs01_00140889 predicted 1087
17 SASI_Hs01_00140890 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138031 predicted 750
2 SASI_Mm01_00138032 predicted 1163
3 SASI_Mm01_00138033 predicted 1456
4 SASI_Mm01_00138035 predicted 522
5 SASI_Mm01_00138036 predicted 1005
6 SASI_Mm02_00335020 predicted 805
7 SASI_Mm01_00138037 predicted 1148
8 SASI_Mm01_00138038 predicted 598
9 SASI_Mm01_00138039 predicted 1291
10 SASI_Mm01_00138040 predicted 600
11 SASI_Mm01_00138034 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029245
ANKRD53 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 53
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-428s21c1
Sequence:CCGGCCGAGTTGTGGAGCCATAAAGCTCGAGCTTTATGGCTCCACAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1369s21c1
Sequence:CCGGGTGCACCCAGAACCCTATAAGCTCGAGCTTATAGGGTTCTGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-667s21c1
Sequence:CCGGCTGCACTTGGTCATCCATAAACTCGAGTTTATGGATGACCAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-608s21c1
Sequence:CCGGTCTTAATAGAGGAGTACAAATCTCGAGATTTGTACTCCTCTATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1410s21c1
Sequence:CCGGCCTGGAGGTGACTCGAAATAACTCGAGTTATTTCGAGTCACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-607s1c1
Sequence:CCGGGTCTTAATAGAGGAGTACAAACTCGAGTTTGTACTCCTCTATTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1285s1c1
Sequence:CCGGCGGCCCAAGTTATGGAACTATCTCGAGATAGTTCCATAACTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1567s1c1
Sequence:CCGGCCACGGGACATACTCAAAGTACTCGAGTACTTTGAGTATGTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029245
ANKRD53 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 53
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-428s21c1
Sequence:CCGGCCGAGTTGTGGAGCCATAAAGCTCGAGCTTTATGGCTCCACAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1369s21c1
Sequence:CCGGGTGCACCCAGAACCCTATAAGCTCGAGCTTATAGGGTTCTGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-667s21c1
Sequence:CCGGCTGCACTTGGTCATCCATAAACTCGAGTTTATGGATGACCAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-608s21c1
Sequence:CCGGTCTTAATAGAGGAGTACAAATCTCGAGATTTGTACTCCTCTATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1410s21c1
Sequence:CCGGCCTGGAGGTGACTCGAAATAACTCGAGTTATTTCGAGTCACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-607s1c1
Sequence:CCGGGTCTTAATAGAGGAGTACAAACTCGAGTTTGTACTCCTCTATTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1285s1c1
Sequence:CCGGCGGCCCAAGTTATGGAACTATCTCGAGATAGTTCCATAACTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1567s1c1
Sequence:CCGGCCACGGGACATACTCAAAGTACTCGAGTACTTTGAGTATGTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029245
ANKRD53 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 53
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-428s21c1
Sequence:CCGGCCGAGTTGTGGAGCCATAAAGCTCGAGCTTTATGGCTCCACAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1369s21c1
Sequence:CCGGGTGCACCCAGAACCCTATAAGCTCGAGCTTATAGGGTTCTGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-667s21c1
Sequence:CCGGCTGCACTTGGTCATCCATAAACTCGAGTTTATGGATGACCAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-608s21c1
Sequence:CCGGTCTTAATAGAGGAGTACAAATCTCGAGATTTGTACTCCTCTATTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029245.1-1410s21c1
Sequence:CCGGCCTGGAGGTGACTCGAAATAACTCGAGTTATTTCGAGTCACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-607s1c1
Sequence:CCGGGTCTTAATAGAGGAGTACAAACTCGAGTTTGTACTCCTCTATTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1285s1c1
Sequence:CCGGCGGCCCAAGTTATGGAACTATCTCGAGATAGTTCCATAACTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029245.1-1567s1c1
Sequence:CCGGCCACGGGACATACTCAAAGTACTCGAGTACTTTGAGTATGTCCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024933
ANKRD53 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 53
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024933.2-1477s1c1
Sequence:CCGGCGCGATGTGGAATGTTAGCAACTCGAGTTGCTAACATTCCACATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1080s1c1
Sequence:CCGGGCACAACTACCTGATTGAGTACTCGAGTACTCAATCAGGTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024933.2-1081s1c1
Sequence:CCGGCACAACTACCTGATTGAGTATCTCGAGATACTCAATCAGGTAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1090s1c1
Sequence:CCGGCTGATTGAGTATCAAGGTCAACTCGAGTTGACCTTGATACTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024933.2-1480s1c1
Sequence:CCGGGATGTGGAATGTTAGCAACAACTCGAGTTGTTGCTAACATTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-919s1c1
Sequence:CCGGCAAGATGCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-806s1c1
Sequence:CCGGCAGACCTCAATGCTCAGACATCTCGAGATGTCTGAGCATTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024933
ANKRD53 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 53
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024933.2-1477s1c1
Sequence:CCGGCGCGATGTGGAATGTTAGCAACTCGAGTTGCTAACATTCCACATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1080s1c1
Sequence:CCGGGCACAACTACCTGATTGAGTACTCGAGTACTCAATCAGGTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024933.2-1081s1c1
Sequence:CCGGCACAACTACCTGATTGAGTATCTCGAGATACTCAATCAGGTAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1090s1c1
Sequence:CCGGCTGATTGAGTATCAAGGTCAACTCGAGTTGACCTTGATACTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024933.2-1480s1c1
Sequence:CCGGGATGTGGAATGTTAGCAACAACTCGAGTTGTTGCTAACATTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-919s1c1
Sequence:CCGGCAAGATGCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-806s1c1
Sequence:CCGGCAGACCTCAATGCTCAGACATCTCGAGATGTCTGAGCATTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024933
ANKRD53 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 53
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024933.2-1477s1c1
Sequence:CCGGCGCGATGTGGAATGTTAGCAACTCGAGTTGCTAACATTCCACATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1080s1c1
Sequence:CCGGGCACAACTACCTGATTGAGTACTCGAGTACTCAATCAGGTAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024933.2-1081s1c1
Sequence:CCGGCACAACTACCTGATTGAGTATCTCGAGATACTCAATCAGGTAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-1090s1c1
Sequence:CCGGCTGATTGAGTATCAAGGTCAACTCGAGTTGACCTTGATACTCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024933.2-1480s1c1
Sequence:CCGGGATGTGGAATGTTAGCAACAACTCGAGTTGTTGCTAACATTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-919s1c1
Sequence:CCGGCAAGATGCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024933.2-806s1c1
Sequence:CCGGCAGACCTCAATGCTCAGACATCTCGAGATGTCTGAGCATTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks