EMAIL THIS PAGE TO A FRIEND

ANKRD54

ankyrin repeat domain 54

Synonyms: LIAR
UniProtKB ID: Q6NXT1, Q6ZSB1, Q9UGV1
Gene ID:
Mouse(223690) ankyrin repeat domain 54
Rat(362957) ankyrin repeat domain 54
naked mole-rat(101716588) ankyrin repeat domain 54
domestic guinea pig(100723926) ankyrin repeat domain 54
sheep(101119635) ankyrin repeat domain 54
Zebrafish(436851) ankyrin repeat domain 54
chicken(418034) ankyrin repeat domain 54
cow(538961) ankyrin repeat domain 54
domestic cat(101099134) ankyrin repeat domain 54
dog(481261) ankyrin repeat domain 54
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138797 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138797 Rosetta Predictions human pricing
NM_001025285 Rosetta Predictions rat pricing
NM_144849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144729 predicted 1246
2 SASI_Hs01_00144730 predicted 793
3 SASI_Hs01_00144731 predicted 770
4 SASI_Hs01_00144732 predicted 1338
5 SASI_Hs01_00144733 predicted 850
6 SASI_Hs01_00144734 predicted 1036
7 SASI_Hs01_00144735 predicted 861
8 SASI_Hs01_00144736 predicted 511
9 SASI_Hs01_00144738 predicted 538
10 SASI_Hs02_00363950 predicted 1052
11 SASI_Hs01_00144737 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088048 predicted 402
2 SASI_Rn01_00088049 predicted 1026
3 SASI_Rn01_00088050 predicted 1026
4 SASI_Rn01_00088052 predicted 856
5 SASI_Rn01_00088053 predicted 926
6 SASI_Rn01_00088054 predicted 1404
7 SASI_Rn01_00088055 predicted 894
8 SASI_Rn01_00088056 predicted 290
9 SASI_Rn01_00088057 predicted 655
10 SASI_Rn02_00203115 predicted 691
11 SASI_Rn01_00088051 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166641 predicted 614
2 SASI_Mm01_00166642 predicted 853
3 SASI_Mm01_00166643 predicted 1163
4 SASI_Mm01_00166644 predicted 1078
5 SASI_Mm01_00166645 predicted 894
6 SASI_Mm01_00166647 predicted 298
7 SASI_Mm01_00166648 predicted 655
8 SASI_Mm01_00166649 predicted 726
9 SASI_Mm01_00166650 predicted 1057
10 SASI_Mm02_00340258 predicted 405
11 SASI_Mm01_00166646 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144849
VALIDATED
ANKRD54 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 54
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144849.1-1509s1c1
Sequence:CCGGCCCAGTTCTCAGTGATTGATACTCGAGTATCAATCACTGAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-411s1c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144849.1-167s1c1
Sequence:CCGGCCTGGTGTCTTTCGCGGACTTCTCGAGAAGTCCGCGAAAGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-860s1c1
Sequence:CCGGCCTCCAGATGACAAGTACCAACTCGAGTTGGTACTTGTCATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-472s1c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-298s21c1
Sequence:CCGGACGAACTGCGTTGCAAGATTCCTCGAGGAATCTTGCAACGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-722s21c1
Sequence:CCGGCATCCTACAGGAGGGTCATTCCTCGAGGAATGACCCTCCTGTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-472s21c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144849.1-1401s21c1
Sequence:CCGGGAGGGACATTGCTCAAGATTACTCGAGTAATCTTGAGCAATGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-411s21c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144849
VALIDATED
ANKRD54 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 54
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144849.1-1509s1c1
Sequence:CCGGCCCAGTTCTCAGTGATTGATACTCGAGTATCAATCACTGAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-411s1c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144849.1-167s1c1
Sequence:CCGGCCTGGTGTCTTTCGCGGACTTCTCGAGAAGTCCGCGAAAGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-860s1c1
Sequence:CCGGCCTCCAGATGACAAGTACCAACTCGAGTTGGTACTTGTCATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-472s1c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-298s21c1
Sequence:CCGGACGAACTGCGTTGCAAGATTCCTCGAGGAATCTTGCAACGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-722s21c1
Sequence:CCGGCATCCTACAGGAGGGTCATTCCTCGAGGAATGACCCTCCTGTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-472s21c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144849.1-1401s21c1
Sequence:CCGGGAGGGACATTGCTCAAGATTACTCGAGTAATCTTGAGCAATGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-411s21c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144849
VALIDATED
ANKRD54 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 54
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144849.1-1509s1c1
Sequence:CCGGCCCAGTTCTCAGTGATTGATACTCGAGTATCAATCACTGAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-411s1c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144849.1-167s1c1
Sequence:CCGGCCTGGTGTCTTTCGCGGACTTCTCGAGAAGTCCGCGAAAGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-860s1c1
Sequence:CCGGCCTCCAGATGACAAGTACCAACTCGAGTTGGTACTTGTCATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144849.1-472s1c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-298s21c1
Sequence:CCGGACGAACTGCGTTGCAAGATTCCTCGAGGAATCTTGCAACGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144849.1-722s21c1
Sequence:CCGGCATCCTACAGGAGGGTCATTCCTCGAGGAATGACCCTCCTGTAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-472s21c1
Sequence:CCGGCAGCGGATGATAAAGGCAGAACTCGAGTTCTGCCTTTATCATCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144849.1-1401s21c1
Sequence:CCGGGAGGGACATTGCTCAAGATTACTCGAGTAATCTTGAGCAATGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144849.1-411s21c1
Sequence:CCGGGCCAATGCCAACGACGTAGAACTCGAGTTCTACGTCGTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138797
ANKRD54 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 54
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1750s1c1
Sequence:CCGGCCAGGAAGATTATCCCAGCTTCTCGAGAAGCTGGGATAATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-862s1c1
Sequence:CCGGGCAGATGACCAGTACCAAAGACTCGAGTCTTTGGTACTGGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1449s1c1
Sequence:CCGGCCAGACTTTCAAGGAGATACTCTCGAGAGTATCTCCTTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-706s1c1
Sequence:CCGGCAAGTCAAAGCTGAATATCCTCTCGAGAGGATATTCAGCTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1573s1c1
Sequence:CCGGCCCAGTCATTGAAACACCAAACTCGAGTTTGGTGTTTCAATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-767s1c1
Sequence:CCGGGAGGTGAAGCAGATCATCCATCTCGAGATGGATGATCTGCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-416s1c1
Sequence:CCGGGCCAATGATGTGGAAACAGTGCTCGAGCACTGTTTCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-498s21c1
Sequence:CCGGTACACTTTGCCTCATGCAATGCTCGAGCATTGCATGAGGCAAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-705s21c1
Sequence:CCGGCCAAGTCAAAGCTGAATATCCCTCGAGGGATATTCAGCTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-616s21c1
Sequence:CCGGCAACCACGTTCCTGTCATCACCTCGAGGTGATGACAGGAACGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-407s21c1
Sequence:CCGGTCGGCCAATGCCAATGATGTGCTCGAGCACATCATTGGCATTGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138797
ANKRD54 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 54
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1750s1c1
Sequence:CCGGCCAGGAAGATTATCCCAGCTTCTCGAGAAGCTGGGATAATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-862s1c1
Sequence:CCGGGCAGATGACCAGTACCAAAGACTCGAGTCTTTGGTACTGGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1449s1c1
Sequence:CCGGCCAGACTTTCAAGGAGATACTCTCGAGAGTATCTCCTTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-706s1c1
Sequence:CCGGCAAGTCAAAGCTGAATATCCTCTCGAGAGGATATTCAGCTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1573s1c1
Sequence:CCGGCCCAGTCATTGAAACACCAAACTCGAGTTTGGTGTTTCAATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-767s1c1
Sequence:CCGGGAGGTGAAGCAGATCATCCATCTCGAGATGGATGATCTGCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-416s1c1
Sequence:CCGGGCCAATGATGTGGAAACAGTGCTCGAGCACTGTTTCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-498s21c1
Sequence:CCGGTACACTTTGCCTCATGCAATGCTCGAGCATTGCATGAGGCAAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-705s21c1
Sequence:CCGGCCAAGTCAAAGCTGAATATCCCTCGAGGGATATTCAGCTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-616s21c1
Sequence:CCGGCAACCACGTTCCTGTCATCACCTCGAGGTGATGACAGGAACGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-407s21c1
Sequence:CCGGTCGGCCAATGCCAATGATGTGCTCGAGCACATCATTGGCATTGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138797
ANKRD54 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 54
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1750s1c1
Sequence:CCGGCCAGGAAGATTATCCCAGCTTCTCGAGAAGCTGGGATAATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-862s1c1
Sequence:CCGGGCAGATGACCAGTACCAAAGACTCGAGTCTTTGGTACTGGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1449s1c1
Sequence:CCGGCCAGACTTTCAAGGAGATACTCTCGAGAGTATCTCCTTGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-706s1c1
Sequence:CCGGCAAGTCAAAGCTGAATATCCTCTCGAGAGGATATTCAGCTTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138797.1-1573s1c1
Sequence:CCGGCCCAGTCATTGAAACACCAAACTCGAGTTTGGTGTTTCAATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-767s1c1
Sequence:CCGGGAGGTGAAGCAGATCATCCATCTCGAGATGGATGATCTGCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138797.1-416s1c1
Sequence:CCGGGCCAATGATGTGGAAACAGTGCTCGAGCACTGTTTCCACATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-498s21c1
Sequence:CCGGTACACTTTGCCTCATGCAATGCTCGAGCATTGCATGAGGCAAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-705s21c1
Sequence:CCGGCCAAGTCAAAGCTGAATATCCCTCGAGGGATATTCAGCTTTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-616s21c1
Sequence:CCGGCAACCACGTTCCTGTCATCACCTCGAGGTGATGACAGGAACGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138797.1-407s21c1
Sequence:CCGGTCGGCCAATGCCAATGATGTGCTCGAGCACATCATTGGCATTGGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks