EMAIL THIS PAGE TO A FRIEND

ANKRD55

ankyrin repeat domain 55

97 Gene Product Result for
UniProtKB ID: Q3KP44, B3KVT8, Q3KP45, Q9HAD3
Gene ID:
Mouse(77318) ankyrin repeat domain 55
Rat(361898) ankyrin repeat domain 55
Zebrafish(100006755) ankyrin repeat domain 55
domestic cat(101090080) ankyrin repeat domain 55
cow(533461) ankyrin repeat domain 55
Horse(100061880) ankyrin repeat domain 55
dog(487214) ankyrin repeat domain 55
chicken(100858831) ankyrin repeat domain 55
sheep(101112514) ankyrin repeat domain 55
domestic guinea pig(100723732) ankyrin repeat domain 55
naked mole-rat(101722189) ankyrin repeat domain 55
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051049 Anti-ANKRD55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024669 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090961 MISSION® esiRNA esiRNA human ANKRD55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039935 Rosetta Predictions human pricing
NM_024669 Rosetta Predictions human pricing
XM_001066855 Rosetta Predictions rat pricing
XM_342195 Rosetta Predictions rat pricing
NM_029898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020132 predicted 1261
2 SASI_Hs01_00020133 predicted 1044
3 SASI_Hs01_00020134 predicted 788
4 SASI_Hs01_00020136 predicted 394
5 SASI_Hs01_00020137 predicted 853
6 SASI_Hs01_00020138 predicted 394
7 SASI_Hs01_00020139 predicted 1285
8 SASI_Hs01_00020140 predicted 1289
9 SASI_Hs01_00020141 predicted 878
10 SASI_Hs02_00308723 predicted 1271
11 SASI_Hs01_00020135 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059058 predicted 1603
2 SASI_Hs01_00059059 predicted 1571
3 SASI_Hs01_00059060 predicted 1275
4 SASI_Hs01_00059061 predicted 1741
5 SASI_Hs02_00357084 predicted 1819
6 SASI_Hs01_00059062 predicted 1570
7 SASI_Hs01_00059063 predicted 1742
8 SASI_Hs01_00059064 predicted 1566
9 SASI_Hs01_00059065 predicted 1434
10 SASI_Hs01_00059066 predicted 1174
11 SASI_Hs01_00059067 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318890 predicted 478
2 SASI_Rn02_00318891 predicted 1143
3 SASI_Rn02_00318892 predicted 716
4 SASI_Rn02_00318893 predicted 527
5 SASI_Rn02_00318894 predicted 855
6 SASI_Rn02_00318895 predicted 1515
7 SASI_Rn02_00318896 predicted 641
8 SASI_Rn02_00318897 predicted 1278
9 SASI_Rn02_00318898 predicted 458
10 SASI_Rn02_00318899 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393896 predicted 1191
2 SASI_Rn02_00393897 predicted 1563
3 SASI_Rn02_00393898 predicted 1498
4 SASI_Rn02_00393899 predicted 1576
5 SASI_Rn02_00393900 predicted 1092
6 SASI_Rn02_00393901 predicted 1228
7 SASI_Rn02_00393902 predicted 1495
8 SASI_Rn02_00393903 predicted 1445
9 SASI_Rn02_00393904 predicted 1225
10 SASI_Rn02_00393905 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104131 predicted 1248
2 SASI_Mm01_00104132 predicted 1720
3 SASI_Mm01_00104133 predicted 2041
4 SASI_Mm01_00104134 predicted 828
5 SASI_Mm02_00336162 predicted 2070
6 SASI_Mm01_00104135 predicted 2063
7 SASI_Mm01_00104136 predicted 345
8 SASI_Mm01_00104137 predicted 1532
9 SASI_Mm01_00104138 predicted 928
10 SASI_Mm02_00336163 predicted 314
11 SASI_Mm01_00104129 predicted 644
12 SASI_Mm01_00104130 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029898
ANKRD55 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 55
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-748s21c1
Sequence:CCGGGCGTATGGTCGCACCAGTTTACTCGAGTAAACTGGTGCGACCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-1345s21c1
Sequence:CCGGAGCAACCTAAGGGACATTAACCTCGAGGTTAATGTCCCTTAGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029898.3-2413s21c1
Sequence:CCGGGGGTGAGATTACTCTAGTTTACTCGAGTAAACTAGAGTAATCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029898.1-2157s1c1
Sequence:CCGGCCCTAAATACTCACTTAGAATCTCGAGATTCTAAGTGAGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-837s1c1
Sequence:CCGGCGGAGACATCATCAACGATTTCTCGAGAAATCGTTGATGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1259s1c1
Sequence:CCGGCCTTTGACAGTGTCGTGGATACTCGAGTATCCACGACACTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-345s1c1
Sequence:CCGGGCTGCTAAAGATGGGTGCCAACTCGAGTTGGCACCCATCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1528s1c1
Sequence:CCGGCGAAGCGAACAGGACTTATTACTCGAGTAATAAGTCCTGTTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029898
ANKRD55 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 55
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-748s21c1
Sequence:CCGGGCGTATGGTCGCACCAGTTTACTCGAGTAAACTGGTGCGACCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-1345s21c1
Sequence:CCGGAGCAACCTAAGGGACATTAACCTCGAGGTTAATGTCCCTTAGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029898.3-2413s21c1
Sequence:CCGGGGGTGAGATTACTCTAGTTTACTCGAGTAAACTAGAGTAATCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029898.1-2157s1c1
Sequence:CCGGCCCTAAATACTCACTTAGAATCTCGAGATTCTAAGTGAGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-837s1c1
Sequence:CCGGCGGAGACATCATCAACGATTTCTCGAGAAATCGTTGATGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1259s1c1
Sequence:CCGGCCTTTGACAGTGTCGTGGATACTCGAGTATCCACGACACTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-345s1c1
Sequence:CCGGGCTGCTAAAGATGGGTGCCAACTCGAGTTGGCACCCATCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1528s1c1
Sequence:CCGGCGAAGCGAACAGGACTTATTACTCGAGTAATAAGTCCTGTTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029898
ANKRD55 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 55
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-748s21c1
Sequence:CCGGGCGTATGGTCGCACCAGTTTACTCGAGTAAACTGGTGCGACCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029898.3-1345s21c1
Sequence:CCGGAGCAACCTAAGGGACATTAACCTCGAGGTTAATGTCCCTTAGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029898.3-2413s21c1
Sequence:CCGGGGGTGAGATTACTCTAGTTTACTCGAGTAAACTAGAGTAATCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029898.1-2157s1c1
Sequence:CCGGCCCTAAATACTCACTTAGAATCTCGAGATTCTAAGTGAGTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-837s1c1
Sequence:CCGGCGGAGACATCATCAACGATTTCTCGAGAAATCGTTGATGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1259s1c1
Sequence:CCGGCCTTTGACAGTGTCGTGGATACTCGAGTATCCACGACACTGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-345s1c1
Sequence:CCGGGCTGCTAAAGATGGGTGCCAACTCGAGTTGGCACCCATCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029898.1-1528s1c1
Sequence:CCGGCGAAGCGAACAGGACTTATTACTCGAGTAATAAGTCCTGTTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024669
ANKRD55 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 55
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-871s21c1
Sequence:CCGGCAGCGGGCTTCAGCGATATTACTCGAGTAATATCGCTGAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-426s21c1
Sequence:CCGGGCTTATGGCCGCACAAGTTTACTCGAGTAAACTTGTGCGGCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-1638s21c1
Sequence:CCGGAGTGATTCTAATCAGGTATTTCTCGAGAAATACCTGATTAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-600s21c1
Sequence:CCGGTCGAACATCAGCGAGATTAATCTCGAGATTAATCTCGCTGATGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024669.2-2073s21c1
Sequence:CCGGTAAGAACGAAGACCAATTTAGCTCGAGCTAAATTGGTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024669.1-1153s1c1
Sequence:CCGGGCATTCTATAAGCCATCAGTTCTCGAGAACTGATGGCTTATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024669
ANKRD55 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 55
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-871s21c1
Sequence:CCGGCAGCGGGCTTCAGCGATATTACTCGAGTAATATCGCTGAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-426s21c1
Sequence:CCGGGCTTATGGCCGCACAAGTTTACTCGAGTAAACTTGTGCGGCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-1638s21c1
Sequence:CCGGAGTGATTCTAATCAGGTATTTCTCGAGAAATACCTGATTAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-600s21c1
Sequence:CCGGTCGAACATCAGCGAGATTAATCTCGAGATTAATCTCGCTGATGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024669.2-2073s21c1
Sequence:CCGGTAAGAACGAAGACCAATTTAGCTCGAGCTAAATTGGTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024669.1-1153s1c1
Sequence:CCGGGCATTCTATAAGCCATCAGTTCTCGAGAACTGATGGCTTATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024669
ANKRD55 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 55
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-871s21c1
Sequence:CCGGCAGCGGGCTTCAGCGATATTACTCGAGTAATATCGCTGAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-426s21c1
Sequence:CCGGGCTTATGGCCGCACAAGTTTACTCGAGTAAACTTGTGCGGCCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-1638s21c1
Sequence:CCGGAGTGATTCTAATCAGGTATTTCTCGAGAAATACCTGATTAGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024669.2-600s21c1
Sequence:CCGGTCGAACATCAGCGAGATTAATCTCGAGATTAATCTCGCTGATGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024669.2-2073s21c1
Sequence:CCGGTAAGAACGAAGACCAATTTAGCTCGAGCTAAATTGGTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147256    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024669.1-1153s1c1
Sequence:CCGGGCATTCTATAAGCCATCAGTTCTCGAGAACTGATGGCTTATAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks