EMAIL THIS PAGE TO A FRIEND

ANKRD60

ankyrin repeat domain 60

79 Gene Product Result for
Synonyms: C20orf86 bA196N14.3
UniProtKB ID: Q9BZ19, Q4VXE6
Gene ID:
Mouse(70065) ankyrin repeat domain 60
Rat(296417) ankyrin repeat domain 60
sheep(101103663) ankyrin repeat domain 60
domestic guinea pig(100735508) ankyrin repeat domain 60
naked mole-rat(101706566) ankyrin repeat domain 60
chicken(419320) ankyrin repeat domain 60
domestic cat(101092924) ankyrin repeat domain 60
dog(477272) ankyrin repeat domain 60
cow(100138827) ankyrin repeat domain 60
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080674 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001134442 Rosetta Predictions human pricing
XM_001134462 Rosetta Predictions human pricing
XM_001717339 Rosetta Predictions human pricing
XM_001054773 Rosetta Predictions rat pricing
XM_001071433 Rosetta Predictions rat pricing
XM_130735 Rosetta Predictions mouse pricing
XM_913826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001134442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392353 predicted 947
2 SASI_Hs02_00392354 predicted 737
3 SASI_Hs02_00392355 predicted 726
4 SASI_Hs02_00392356 predicted 632
5 SASI_Hs02_00392357 predicted 620
6 SASI_Hs02_00392358 predicted 843
7 SASI_Hs02_00392359 predicted 638
8 SASI_Hs02_00392360 predicted 752
9 SASI_Hs02_00392361 predicted 819
10 SASI_Hs02_00392362 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001134462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392373 predicted 947
2 SASI_Hs02_00392374 predicted 733
3 SASI_Hs02_00392375 predicted 726
4 SASI_Hs02_00392376 predicted 630
5 SASI_Hs02_00392377 predicted 615
6 SASI_Hs02_00392378 predicted 841
7 SASI_Hs02_00392379 predicted 636
8 SASI_Hs02_00392380 predicted 753
9 SASI_Hs02_00392381 predicted 822
10 SASI_Hs02_00392382 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416617 predicted 945
2 SASI_Hs02_00416618 predicted 741
3 SASI_Hs02_00416619 predicted 722
4 SASI_Hs02_00416620 predicted 636
5 SASI_Hs02_00416621 predicted 617
6 SASI_Hs02_00416622 predicted 848
7 SASI_Hs02_00416623 predicted 636
8 SASI_Hs02_00416624 predicted 751
9 SASI_Hs02_00416625 predicted 817
10 SASI_Hs02_00416626 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277139 predicted 346
2 SASI_Rn02_00277140 predicted 208
3 SASI_Rn02_00277141 predicted 420
4 SASI_Rn02_00277142 predicted 260
5 SASI_Rn02_00277143 predicted 457
6 SASI_Rn02_00277144 predicted 557
7 SASI_Rn02_00277145 predicted 325
8 SASI_Rn02_00277146 predicted 556
9 SASI_Rn02_00277147 predicted 237
10 SASI_Rn02_00277148 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335149 predicted 248
2 SASI_Rn02_00335150 predicted 492
3 SASI_Rn02_00335151 predicted 444
4 SASI_Rn02_00335152 predicted 490
5 SASI_Rn02_00335153 predicted 316
6 SASI_Rn02_00335154 predicted 301
7 SASI_Rn02_00335155 predicted 394
8 SASI_Rn02_00335156 predicted 502
9 SASI_Rn02_00335157 predicted 251
10 SASI_Rn02_00335158 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255390 predicted 273
2 SASI_Mm01_00255391 predicted 233
3 SASI_Mm01_00255392 predicted 243
4 SASI_Mm01_00255393 predicted 265
5 SASI_Mm01_00255394 predicted 254
6 SASI_Mm01_00255395 predicted 267
7 SASI_Mm01_00255396 predicted 230
8 SASI_Mm01_00255397 predicted 247
9 SASI_Mm01_00255398 predicted 249
10 SASI_Mm02_00424384 predicted 266
11 SASI_Mm01_00255399 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438048 predicted 324
2 SASI_Mm02_00438049 predicted 425
3 SASI_Mm02_00438050 predicted 409
4 SASI_Mm02_00438051 predicted 424
5 SASI_Mm02_00438052 predicted 551
6 SASI_Mm02_00438053 predicted 315
7 SASI_Mm02_00438054 predicted 249
8 SASI_Mm02_00438055 predicted 292
9 SASI_Mm02_00438056 predicted 478
10 SASI_Mm02_00438057 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080674
ANKRD60 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 60
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000011137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-452s1c1
Sequence:CCGGCTGGAGGGATTATTTCATTATCTCGAGATAATGAAATAATCCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011140    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080674.1-974s1c1
Sequence:CCGGCTGGGTTTAGGTCTGAGAAGACTCGAGTCTTCTCAGACCTAAACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-777s1c1
Sequence:CCGGCTGTATAATCCTCCTGCTCCACTCGAGTGGAGCAGGAGGATTATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-414s1c1
Sequence:CCGGGATGGATGACACTACCCTGAACTCGAGTTCAGGGTAGTGTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080674
ANKRD60 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 60
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000011137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-452s1c1
Sequence:CCGGCTGGAGGGATTATTTCATTATCTCGAGATAATGAAATAATCCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011140    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080674.1-974s1c1
Sequence:CCGGCTGGGTTTAGGTCTGAGAAGACTCGAGTCTTCTCAGACCTAAACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-777s1c1
Sequence:CCGGCTGTATAATCCTCCTGCTCCACTCGAGTGGAGCAGGAGGATTATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-414s1c1
Sequence:CCGGGATGGATGACACTACCCTGAACTCGAGTTCAGGGTAGTGTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080674
ANKRD60 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 60
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000011137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-452s1c1
Sequence:CCGGCTGGAGGGATTATTTCATTATCTCGAGATAATGAAATAATCCCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011140    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_080674.1-974s1c1
Sequence:CCGGCTGGGTTTAGGTCTGAGAAGACTCGAGTCTTCTCAGACCTAAACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-777s1c1
Sequence:CCGGCTGTATAATCCTCCTGCTCCACTCGAGTGGAGCAGGAGGATTATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080674.1-414s1c1
Sequence:CCGGGATGGATGACACTACCCTGAACTCGAGTTCAGGGTAGTGTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks