EMAIL THIS PAGE TO A FRIEND

ANKRD61

ankyrin repeat domain 61

UniProtKB ID: A6NGH8
Gene ID:
Mouse(66729) ankyrin repeat domain 61
Rat(689907) ankyrin repeat domain 61
cow(768013) ankyrin repeat domain 61
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305214 ANTI-ANKRD61(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084111 MISSION® esiRNA esiRNA targeting mouse 4921520G13Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044297 Rosetta Predictions rat pricing
NM_025732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205644 predicted 1124
2 SASI_Rn02_00205645 predicted 1116
3 SASI_Rn02_00205646 predicted 1001
4 SASI_Rn02_00205647 predicted 999
5 SASI_Rn02_00205648 predicted 1091
6 SASI_Rn02_00205649 predicted 757
7 SASI_Rn02_00205650 predicted 968
8 SASI_Rn02_00205651 predicted 927
9 SASI_Rn02_00205652 predicted 568
10 SASI_Rn02_00205653 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026225 predicted 970
2 SASI_Mm01_00026226 predicted 1136
3 SASI_Mm01_00026227 predicted 339
4 SASI_Mm01_00026228 predicted 511
5 SASI_Mm01_00026229 predicted 1193
6 SASI_Mm01_00026230 predicted 1087
7 SASI_Mm01_00026231 predicted 806
8 SASI_Mm01_00026232 predicted 901
9 SASI_Mm01_00026233 predicted 303
10 SASI_Mm01_00026234 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025732
ANKRD61 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 61
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-655s1c1
Sequence:CCGGGCCCAGGTCAATGCTACTAATCTCGAGATTAGTAGCATTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1076s1c1
Sequence:CCGGCCAGACTACTTTACCGCACTTCTCGAGAAGTGCGGTAAAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1078s1c1
Sequence:CCGGAGACTACTTTACCGCACTTATCTCGAGATAAGTGCGGTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1164s1c1
Sequence:CCGGCCTAAGGGAAACCCTAGTAAACTCGAGTTTACTAGGGTTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-340s1c1
Sequence:CCGGCGCAAGCCACAAAGTTTGCTTCTCGAGAAGCAAACTTTGTGGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-295s21c1
Sequence:CCGGAGCAGACACAGCCTATCTTTCCTCGAGGAAAGATAGGCTGTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-1136s21c1
Sequence:CCGGAGGAATCATGCTGCCAGAATACTCGAGTATTCTGGCAGCATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-540s21c1
Sequence:CCGGGACCACGGAGCTCAAGTTAATCTCGAGATTAACTTGAGCTCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025732
ANKRD61 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 61
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-655s1c1
Sequence:CCGGGCCCAGGTCAATGCTACTAATCTCGAGATTAGTAGCATTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1076s1c1
Sequence:CCGGCCAGACTACTTTACCGCACTTCTCGAGAAGTGCGGTAAAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1078s1c1
Sequence:CCGGAGACTACTTTACCGCACTTATCTCGAGATAAGTGCGGTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1164s1c1
Sequence:CCGGCCTAAGGGAAACCCTAGTAAACTCGAGTTTACTAGGGTTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-340s1c1
Sequence:CCGGCGCAAGCCACAAAGTTTGCTTCTCGAGAAGCAAACTTTGTGGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-295s21c1
Sequence:CCGGAGCAGACACAGCCTATCTTTCCTCGAGGAAAGATAGGCTGTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-1136s21c1
Sequence:CCGGAGGAATCATGCTGCCAGAATACTCGAGTATTCTGGCAGCATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-540s21c1
Sequence:CCGGGACCACGGAGCTCAAGTTAATCTCGAGATTAACTTGAGCTCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025732
ANKRD61 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 61
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-655s1c1
Sequence:CCGGGCCCAGGTCAATGCTACTAATCTCGAGATTAGTAGCATTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1076s1c1
Sequence:CCGGCCAGACTACTTTACCGCACTTCTCGAGAAGTGCGGTAAAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1078s1c1
Sequence:CCGGAGACTACTTTACCGCACTTATCTCGAGATAAGTGCGGTAAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-1164s1c1
Sequence:CCGGCCTAAGGGAAACCCTAGTAAACTCGAGTTTACTAGGGTTTCCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025732.1-340s1c1
Sequence:CCGGCGCAAGCCACAAAGTTTGCTTCTCGAGAAGCAAACTTTGTGGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-295s21c1
Sequence:CCGGAGCAGACACAGCCTATCTTTCCTCGAGGAAAGATAGGCTGTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-1136s21c1
Sequence:CCGGAGGAATCATGCTGCCAGAATACTCGAGTATTCTGGCAGCATGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025732.3-540s21c1
Sequence:CCGGGACCACGGAGCTCAAGTTAATCTCGAGATTAACTTGAGCTCCGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks