EMAIL THIS PAGE TO A FRIEND

ANKRD63

ankyrin repeat domain 63

67 Gene Product Result for
UniProtKB ID: C9JTQ0
Gene ID:
Mouse(383787) ankyrin repeat domain 63
Rat(691770) ankyrin repeat domain 63
cow(100140532) ankyrin repeat domain 63
dog(608375) ankyrin repeat domain 63
domestic cat(101087409) ankyrin repeat domain 63
domestic guinea pig(100713860) ankyrin repeat domain 63
naked mole-rat(101708036) ankyrin repeat domain 63
sheep(101112823) ankyrin repeat domain 63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305893 ANTI-ANKRD63 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186711 MISSION® esiRNA esiRNA targeting mouse Gm1337 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719946 Rosetta Predictions human pricing
XM_001724055 Rosetta Predictions human pricing
XM_001725332 Rosetta Predictions human pricing
XM_001079587 Rosetta Predictions rat pricing
NM_001081971 Rosetta Predictions mouse pricing
XM_357250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433604 predicted 822
2 SASI_Hs02_00433605 predicted 817
3 SASI_Hs02_00433606 predicted 205
4 SASI_Hs02_00433607 predicted 222
5 SASI_Hs02_00433608 predicted 215
6 SASI_Hs02_00433609 predicted 292
7 SASI_Hs02_00433610 predicted 861
8 SASI_Hs02_00433611 predicted 202
9 SASI_Hs02_00433612 predicted 868
10 SASI_Hs02_00433613 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00459214 predicted 821
2 SASI_Hs02_00459215 predicted 825
3 SASI_Hs02_00459216 predicted 212
4 SASI_Hs02_00459217 predicted 224
5 SASI_Hs02_00459218 predicted 212
6 SASI_Hs02_00459219 predicted 293
7 SASI_Hs02_00459220 predicted 867
8 SASI_Hs02_00459221 predicted 202
9 SASI_Hs02_00459222 predicted 869
10 SASI_Hs02_00459223 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467003 predicted 816
2 SASI_Hs02_00467004 predicted 826
3 SASI_Hs02_00467005 predicted 209
4 SASI_Hs02_00467006 predicted 218
5 SASI_Hs02_00467007 predicted 210
6 SASI_Hs02_00467008 predicted 289
7 SASI_Hs02_00467009 predicted 860
8 SASI_Hs02_00467010 predicted 209
9 SASI_Hs02_00467011 predicted 872
10 SASI_Hs02_00467012 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364769 predicted 2021
2 SASI_Rn02_00364770 predicted 1716
3 SASI_Rn02_00364771 predicted 1593
4 SASI_Rn02_00364772 predicted 1347
5 SASI_Rn02_00364773 predicted 1829
6 SASI_Rn02_00364774 predicted 1869
7 SASI_Rn02_00364775 predicted 1646
8 SASI_Rn02_00364776 predicted 1768
9 SASI_Rn02_00364777 predicted 1044
10 SASI_Rn02_00364778 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299142 predicted 1894
2 SASI_Mm02_00299143 predicted 1248
3 SASI_Mm02_00299144 predicted 1771
4 SASI_Mm02_00299145 predicted 749
5 SASI_Mm02_00299146 predicted 1703
6 SASI_Mm02_00299147 predicted 1372
7 SASI_Mm02_00299148 predicted 1159
8 SASI_Mm02_00299149 predicted 2050
9 SASI_Mm02_00299150 predicted 1732
10 SASI_Mm02_00299151 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262134 predicted 1903
2 SASI_Mm01_00262135 predicted 1252
3 SASI_Mm01_00262136 predicted 1771
4 SASI_Mm01_00262137 predicted 747
5 SASI_Mm01_00262138 predicted 1709
6 SASI_Mm01_00262139 predicted 1383
7 SASI_Mm01_00262140 predicted 1157
8 SASI_Mm01_00262141 predicted 2049
9 SASI_Mm01_00262142 predicted 1741
10 SASI_Mm01_00262143 predicted 1284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081971
ANKRD63 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 63
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1380s21c1
Sequence:CCGGAGCTCTGATGGCTCGACCAAACTCGAGTTTGGTCGAGCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1591s21c1
Sequence:CCGGCCTGAGAGTGGCCCAGAATTACTCGAGTAATTCTGGGCCACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1280s21c1
Sequence:CCGGGTTATAGGGCACAAGGCAATGCTCGAGCATTGCCTTGTGCCCTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081971.1-1878s21c1
Sequence:CCGGTTGGTATTTCCCACGTAAATCCTCGAGGATTTACGTGGGAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-925s21c1
Sequence:CCGGGAGTTCTTGGTGCGCTCTTTCCTCGAGGAAAGAGCGCACCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081971
ANKRD63 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 63
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1380s21c1
Sequence:CCGGAGCTCTGATGGCTCGACCAAACTCGAGTTTGGTCGAGCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1591s21c1
Sequence:CCGGCCTGAGAGTGGCCCAGAATTACTCGAGTAATTCTGGGCCACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1280s21c1
Sequence:CCGGGTTATAGGGCACAAGGCAATGCTCGAGCATTGCCTTGTGCCCTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081971.1-1878s21c1
Sequence:CCGGTTGGTATTTCCCACGTAAATCCTCGAGGATTTACGTGGGAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-925s21c1
Sequence:CCGGGAGTTCTTGGTGCGCTCTTTCCTCGAGGAAAGAGCGCACCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081971
ANKRD63 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 63
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1380s21c1
Sequence:CCGGAGCTCTGATGGCTCGACCAAACTCGAGTTTGGTCGAGCCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1591s21c1
Sequence:CCGGCCTGAGAGTGGCCCAGAATTACTCGAGTAATTCTGGGCCACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-1280s21c1
Sequence:CCGGGTTATAGGGCACAAGGCAATGCTCGAGCATTGCCTTGTGCCCTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081971.1-1878s21c1
Sequence:CCGGTTGGTATTTCCCACGTAAATCCTCGAGGATTTACGTGGGAAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081971.1-925s21c1
Sequence:CCGGGAGTTCTTGGTGCGCTCTTTCCTCGAGGAAAGAGCGCACCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks