EMAIL THIS PAGE TO A FRIEND

ANKRD66

ankyrin repeat domain 66

UniProtKB ID: B4E2M5
Gene ID:
Mouse(100043332) ankyrin repeat domain 66
Rat(501105) ankyrin repeat domain 66
cow(785478) ankyrin repeat domain 66
domestic guinea pig(100732495) ankyrin repeat domain 66
naked mole-rat(101716479) ankyrin repeat domain 66
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001162435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001162435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001068682 Rosetta Predictions rat pricing
XM_576520 Rosetta Predictions rat pricing
XM_001479985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325469 predicted 541
2 SASI_Rn02_00325470 predicted 702
3 SASI_Rn02_00325471 predicted 677
4 SASI_Rn02_00325472 predicted 422
5 SASI_Rn02_00325473 predicted 238
6 SASI_Rn02_00325474 predicted 442
7 SASI_Rn02_00325475 predicted 277
8 SASI_Rn02_00325476 predicted 227
9 SASI_Rn02_00325477 predicted 660
10 SASI_Rn02_00325478 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141276 predicted 537
2 SASI_Rn01_00141277 predicted 696
3 SASI_Rn01_00141278 predicted 668
4 SASI_Rn02_00405488 predicted 425
5 SASI_Rn01_00141279 predicted 234
6 SASI_Rn01_00141280 predicted 448
7 SASI_Rn01_00141281 predicted 279
8 SASI_Rn01_00141282 predicted 224
9 SASI_Rn01_00141283 predicted 659
10 SASI_Rn01_00141284 predicted 315
11 SASI_Rn01_00141285 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414183 predicted 230
2 SASI_Mm02_00414184 predicted 313
3 SASI_Mm02_00414185 predicted 229
4 SASI_Mm02_00414186 predicted 234
5 SASI_Mm02_00414187 predicted 195
6 SASI_Mm02_00414188 predicted 196
7 SASI_Mm02_00414189 predicted 255
8 SASI_Mm02_00414190 predicted 310
9 SASI_Mm02_00414191 predicted 311
10 SASI_Mm02_00414192 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162435
ANKRD66 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 66
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-710s21c1
Sequence:CCGGAGTATGAGAACTCAACCTTATCTCGAGATAAGGTTGAGTTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-622s21c1
Sequence:CCGGTGTCTCTTCCTTCCCTAAATCCTCGAGGATTTAGGGAAGGAAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-302s21c1
Sequence:CCGGGATACGGCTCCTGATAGAATACTCGAGTATTCTATCAGGAGCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162435.1-746s21c1
Sequence:CCGGACTTTCCCTGGTGCCAGAAATCTCGAGATTTCTGGCACCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-379s21c1
Sequence:CCGGCAGAAGCAGGCCATCTGAATACTCGAGTATTCAGATGGCCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162435
ANKRD66 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 66
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-710s21c1
Sequence:CCGGAGTATGAGAACTCAACCTTATCTCGAGATAAGGTTGAGTTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-622s21c1
Sequence:CCGGTGTCTCTTCCTTCCCTAAATCCTCGAGGATTTAGGGAAGGAAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-302s21c1
Sequence:CCGGGATACGGCTCCTGATAGAATACTCGAGTATTCTATCAGGAGCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162435.1-746s21c1
Sequence:CCGGACTTTCCCTGGTGCCAGAAATCTCGAGATTTCTGGCACCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-379s21c1
Sequence:CCGGCAGAAGCAGGCCATCTGAATACTCGAGTATTCAGATGGCCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162435
ANKRD66 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 66
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-710s21c1
Sequence:CCGGAGTATGAGAACTCAACCTTATCTCGAGATAAGGTTGAGTTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-622s21c1
Sequence:CCGGTGTCTCTTCCTTCCCTAAATCCTCGAGGATTTAGGGAAGGAAGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-302s21c1
Sequence:CCGGGATACGGCTCCTGATAGAATACTCGAGTATTCTATCAGGAGCCGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162435.1-746s21c1
Sequence:CCGGACTTTCCCTGGTGCCAGAAATCTCGAGATTTCTGGCACCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162435.1-379s21c1
Sequence:CCGGCAGAAGCAGGCCATCTGAATACTCGAGTATTCAGATGGCCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks