EMAIL THIS PAGE TO A FRIEND

ANKRD6

ankyrin repeat domain 6

80 Gene Product Result for
Gene ID:
Mouse(140577) ankyrin repeat domain 6
Rat(500430) ankyrin repeat domain 6
chicken(421813) ankyrin repeat domain 6
cow(516065) ankyrin repeat domain 6
Horse(100071064) ankyrin repeat domain 6
domestic cat(101094349) ankyrin repeat domain 6
dog(481919) ankyrin repeat domain 6
naked mole-rat(101721775) ankyrin repeat domain 6
domestic guinea pig(100712998) ankyrin repeat domain 6
sheep(101109885) ankyrin repeat domain 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014942 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054751 MISSION® esiRNA esiRNA targeting mouse Ankrd6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014942 Rosetta Predictions human pricing
NM_001134969 Rosetta Predictions rat pricing
NM_001012450 Rosetta Predictions mouse pricing
NM_001012451 Rosetta Predictions mouse pricing
NM_080471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229295 predicted 1554
2 SASI_Hs01_00229296 predicted 597
3 SASI_Hs02_00346615 predicted 2506
4 SASI_Hs01_00229298 predicted 2167
5 SASI_Hs01_00229299 predicted 1870
6 SASI_Hs01_00229300 predicted 1578
7 SASI_Hs01_00229301 predicted 1929
8 SASI_Hs01_00229302 predicted 2417
9 SASI_Hs01_00229303 predicted 1540
10 SASI_Hs01_00229304 predicted 663
11 SASI_Hs01_00229297 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259144 predicted 502
2 SASI_Rn02_00259145 predicted 515
3 SASI_Rn02_00259146 predicted 1857
4 SASI_Rn02_00259147 predicted 1848
5 SASI_Rn02_00259148 predicted 2583
6 SASI_Rn02_00259149 predicted 686
7 SASI_Rn02_00259150 predicted 387
8 SASI_Rn02_00259151 predicted 1884
9 SASI_Rn02_00259152 predicted 671
10 SASI_Rn02_00259153 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080453 predicted 661
2 SASI_Mm01_00080455 predicted 1793
3 SASI_Mm01_00080456 predicted 892
4 SASI_Mm01_00080457 predicted 2178
5 SASI_Mm02_00287115 predicted 1989
6 SASI_Mm01_00080458 predicted 2046
7 SASI_Mm01_00080459 predicted 1918
8 SASI_Mm01_00080460 predicted 2251
9 SASI_Mm02_00287116 predicted 1157
10 SASI_Mm01_00080461 predicted 864
11 SASI_Mm01_00080454 predicted 677
12 SASI_Mm01_00080462 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031143 predicted 371
2 SASI_Mm01_00031145 predicted 1506
3 SASI_Mm01_00031146 predicted 602
4 SASI_Mm01_00031147 predicted 1887
5 SASI_Mm02_00287117 predicted 1696
6 SASI_Mm01_00031148 predicted 1761
7 SASI_Mm01_00031149 predicted 1637
8 SASI_Mm01_00031150 predicted 1961
9 SASI_Mm02_00287118 predicted 867
10 SASI_Mm01_00031151 predicted 576
11 SASI_Mm01_00031144 predicted 393
12 SASI_Mm01_00031152 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033816 predicted 499
2 SASI_Mm01_00033818 predicted 1636
3 SASI_Mm01_00033819 predicted 729
4 SASI_Mm01_00033820 predicted 2024
5 SASI_Mm02_00338147 predicted 1827
6 SASI_Mm01_00033821 predicted 1894
7 SASI_Mm01_00033822 predicted 1757
8 SASI_Mm01_00033823 predicted 2093
9 SASI_Mm02_00338148 predicted 993
10 SASI_Mm01_00033824 predicted 703
11 SASI_Mm01_00033817 predicted 515
12 SASI_Mm01_00033825 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080471
ANKRD6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-2100s1c1
Sequence:CCGGCCCTGGAGCTAACTCAGTATTCTCGAGAATACTGAGTTAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1462s1c1
Sequence:CCGGGCAGGATAAAGTGAACGCGAACTCGAGTTCGCGTTCACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1625s1c1
Sequence:CCGGCGTCAGATGTCTTTGGTAGATCTCGAGATCTACCAAAGACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-294s1c1
Sequence:CCGGCTGCCAATAAGGGTCATCTTTCTCGAGAAAGATGACCCTTATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-794s1c1
Sequence:CCGGGCCCTAAATCACAAGAAGGTACTCGAGTACCTTCTTGTGATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2520s21c1
Sequence:CCGGACAGGGTTTCCGGCTTGATAACTCGAGTTATCAAGCCGGAAACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080471.3-1586s21c1
Sequence:CCGGTTGTCGCTGTGAACCTCTAATCTCGAGATTAGAGGTTCACAGCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2975s21c1
Sequence:CCGGTCATGTAAAGAAGGAGTAATTCTCGAGAATTACTCCTTCTTTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080471
ANKRD6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-2100s1c1
Sequence:CCGGCCCTGGAGCTAACTCAGTATTCTCGAGAATACTGAGTTAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1462s1c1
Sequence:CCGGGCAGGATAAAGTGAACGCGAACTCGAGTTCGCGTTCACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1625s1c1
Sequence:CCGGCGTCAGATGTCTTTGGTAGATCTCGAGATCTACCAAAGACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-294s1c1
Sequence:CCGGCTGCCAATAAGGGTCATCTTTCTCGAGAAAGATGACCCTTATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-794s1c1
Sequence:CCGGGCCCTAAATCACAAGAAGGTACTCGAGTACCTTCTTGTGATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2520s21c1
Sequence:CCGGACAGGGTTTCCGGCTTGATAACTCGAGTTATCAAGCCGGAAACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080471.3-1586s21c1
Sequence:CCGGTTGTCGCTGTGAACCTCTAATCTCGAGATTAGAGGTTCACAGCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2975s21c1
Sequence:CCGGTCATGTAAAGAAGGAGTAATTCTCGAGAATTACTCCTTCTTTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080471
ANKRD6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-2100s1c1
Sequence:CCGGCCCTGGAGCTAACTCAGTATTCTCGAGAATACTGAGTTAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1462s1c1
Sequence:CCGGGCAGGATAAAGTGAACGCGAACTCGAGTTCGCGTTCACTTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-1625s1c1
Sequence:CCGGCGTCAGATGTCTTTGGTAGATCTCGAGATCTACCAAAGACATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-294s1c1
Sequence:CCGGCTGCCAATAAGGGTCATCTTTCTCGAGAAAGATGACCCTTATTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080471.2-794s1c1
Sequence:CCGGGCCCTAAATCACAAGAAGGTACTCGAGTACCTTCTTGTGATTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2520s21c1
Sequence:CCGGACAGGGTTTCCGGCTTGATAACTCGAGTTATCAAGCCGGAAACCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080471.3-1586s21c1
Sequence:CCGGTTGTCGCTGTGAACCTCTAATCTCGAGATTAGAGGTTCACAGCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080471.3-2975s21c1
Sequence:CCGGTCATGTAAAGAAGGAGTAATTCTCGAGAATTACTCCTTCTTTACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014942
VALIDATED
ANKRD6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-2311s1c1
Sequence:CCGGGCTGTTTCTACCCAGATGGAACTCGAGTTCCATCTGGGTAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2544s1c1
Sequence:CCGGCCCAAGGAGTCAACTATTGTACTCGAGTACAATAGTTGACTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-892s1c1
Sequence:CCGGGCTTTCTGTTCTGTCCATGAACTCGAGTTCATGGACAGAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2545s1c1
Sequence:CCGGCCAAGGAGTCAACTATTGTATCTCGAGATACAATAGTTGACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2735s1c1
Sequence:CCGGGAAGTTTGAAAGCTCAGATTACTCGAGTAATCTGAGCTTTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1555s1c1
Sequence:CCGGCTAATCAACAAGCTGGAGAATCTCGAGATTCTCCAGCTTGTTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1895s1c1
Sequence:CCGGCATCTACTTGTGTGGACCAATCTCGAGATTGGTCCACACAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1401s1c1
Sequence:CCGGGCATGCTCATAATCACCCTAACTCGAGTTAGGGTGATTATGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014942.2-1877s1c1
Sequence:CCGGGCAGAGCTAAATCCACACCATCTCGAGATGGTGTGGATTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014942
VALIDATED
ANKRD6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-2311s1c1
Sequence:CCGGGCTGTTTCTACCCAGATGGAACTCGAGTTCCATCTGGGTAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2544s1c1
Sequence:CCGGCCCAAGGAGTCAACTATTGTACTCGAGTACAATAGTTGACTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-892s1c1
Sequence:CCGGGCTTTCTGTTCTGTCCATGAACTCGAGTTCATGGACAGAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2545s1c1
Sequence:CCGGCCAAGGAGTCAACTATTGTATCTCGAGATACAATAGTTGACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2735s1c1
Sequence:CCGGGAAGTTTGAAAGCTCAGATTACTCGAGTAATCTGAGCTTTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1555s1c1
Sequence:CCGGCTAATCAACAAGCTGGAGAATCTCGAGATTCTCCAGCTTGTTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1895s1c1
Sequence:CCGGCATCTACTTGTGTGGACCAATCTCGAGATTGGTCCACACAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1401s1c1
Sequence:CCGGGCATGCTCATAATCACCCTAACTCGAGTTAGGGTGATTATGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014942.2-1877s1c1
Sequence:CCGGGCAGAGCTAAATCCACACCATCTCGAGATGGTGTGGATTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014942
VALIDATED
ANKRD6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-2311s1c1
Sequence:CCGGGCTGTTTCTACCCAGATGGAACTCGAGTTCCATCTGGGTAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2544s1c1
Sequence:CCGGCCCAAGGAGTCAACTATTGTACTCGAGTACAATAGTTGACTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-892s1c1
Sequence:CCGGGCTTTCTGTTCTGTCCATGAACTCGAGTTCATGGACAGAACAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2545s1c1
Sequence:CCGGCCAAGGAGTCAACTATTGTATCTCGAGATACAATAGTTGACTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014942.2-2735s1c1
Sequence:CCGGGAAGTTTGAAAGCTCAGATTACTCGAGTAATCTGAGCTTTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1555s1c1
Sequence:CCGGCTAATCAACAAGCTGGAGAATCTCGAGATTCTCCAGCTTGTTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1895s1c1
Sequence:CCGGCATCTACTTGTGTGGACCAATCTCGAGATTGGTCCACACAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014942.2-1401s1c1
Sequence:CCGGGCATGCTCATAATCACCCTAACTCGAGTTAGGGTGATTATGAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014942.2-1877s1c1
Sequence:CCGGGCAGAGCTAAATCCACACCATCTCGAGATGGTGTGGATTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks