EMAIL THIS PAGE TO A FRIEND

ANKRD7

ankyrin repeat domain 7

68 Gene Product Result for
Synonyms: TSA806
UniProtKB ID: Q92527, B4DYF5, Q96QN1, Q9UDM3
Gene ID:
Mouse(75196) ankyrin repeat domain 7
Rat(502733) ankyrin repeat domain 7
chicken(770594) ankyrin repeat domain 7
sheep(101121676) ankyrin repeat domain 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019644 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087491 MISSION® esiRNA esiRNA human ANKRD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077708 Rosetta Predictions human pricing
NM_019644 Rosetta Predictions human pricing
XM_001059438 Rosetta Predictions rat pricing
XM_578232 Rosetta Predictions rat pricing
NM_029202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313226 predicted 827
2 SASI_Hs02_00313227 predicted 695
3 SASI_Hs02_00313228 predicted 717
4 SASI_Hs02_00313229 predicted 704
5 SASI_Hs02_00313230 predicted 808
6 SASI_Hs02_00313231 predicted 708
7 SASI_Hs02_00313232 predicted 617
8 SASI_Hs02_00313233 predicted 702
9 SASI_Hs02_00313234 predicted 620
10 SASI_Hs02_00313235 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099126 predicted 765
2 SASI_Hs01_00099127 predicted 634
3 SASI_Hs01_00099130 predicted 661
4 SASI_Hs01_00099132 predicted 641
5 SASI_Hs01_00099133 predicted 746
6 SASI_Hs02_00352847 predicted 646
7 SASI_Hs01_00099134 predicted 561
8 SASI_Hs01_00099135 predicted 650
9 SASI_Hs02_00352848 predicted 561
10 SASI_Hs02_00352849 predicted 639
11 SASI_Hs01_00099128 predicted 291
12 SASI_Hs01_00099129 predicted 281
13 SASI_Hs01_00099131 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293177 predicted 252
2 SASI_Rn02_00293178 predicted 379
3 SASI_Rn02_00293179 predicted 410
4 SASI_Rn02_00293180 predicted 261
5 SASI_Rn02_00293181 predicted 371
6 SASI_Rn02_00293182 predicted 434
7 SASI_Rn02_00293183 predicted 192
8 SASI_Rn02_00293184 predicted 418
9 SASI_Rn02_00293185 predicted 646
10 SASI_Rn02_00293186 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407717 predicted 252
2 SASI_Rn02_00407718 predicted 371
3 SASI_Rn02_00407719 predicted 485
4 SASI_Rn02_00407720 predicted 412
5 SASI_Rn02_00407721 predicted 261
6 SASI_Rn02_00407722 predicted 375
7 SASI_Rn02_00407723 predicted 431
8 SASI_Rn02_00407724 predicted 199
9 SASI_Rn02_00407725 predicted 421
10 SASI_Rn02_00407726 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172379 predicted 882
2 SASI_Mm01_00172381 predicted 579
3 SASI_Mm01_00172382 predicted 590
4 SASI_Mm01_00172383 predicted 289
5 SASI_Mm01_00172384 predicted 265
6 SASI_Mm01_00172385 predicted 429
7 SASI_Mm01_00172386 predicted 832
8 SASI_Mm01_00172387 predicted 366
9 SASI_Mm01_00172388 predicted 599
10 SASI_Mm02_00334999 predicted 910
11 SASI_Mm01_00172380 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029202
ANKRD7 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029202.1-1100s1c1
Sequence:CCGGCCTCTGCTTTGAAATTGTAAACTCGAGTTTACAATTTCAAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-370s1c1
Sequence:CCGGCGCAAGAAATACAATGTGAATCTCGAGATTCACATTGTATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-811s1c1
Sequence:CCGGGCCATCATGATTGCTCTGATTCTCGAGAATCAGAGCAATCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-428s1c1
Sequence:CCGGCCTGTGCTAATGGATATACAACTCGAGTTGTATATCCATTAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-291s1c1
Sequence:CCGGCCTTCGAGATAAGCACTTAAACTCGAGTTTAAGTGCTTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029202
ANKRD7 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029202.1-1100s1c1
Sequence:CCGGCCTCTGCTTTGAAATTGTAAACTCGAGTTTACAATTTCAAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-370s1c1
Sequence:CCGGCGCAAGAAATACAATGTGAATCTCGAGATTCACATTGTATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-811s1c1
Sequence:CCGGGCCATCATGATTGCTCTGATTCTCGAGAATCAGAGCAATCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-428s1c1
Sequence:CCGGCCTGTGCTAATGGATATACAACTCGAGTTGTATATCCATTAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-291s1c1
Sequence:CCGGCCTTCGAGATAAGCACTTAAACTCGAGTTTAAGTGCTTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029202
ANKRD7 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029202.1-1100s1c1
Sequence:CCGGCCTCTGCTTTGAAATTGTAAACTCGAGTTTACAATTTCAAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-370s1c1
Sequence:CCGGCGCAAGAAATACAATGTGAATCTCGAGATTCACATTGTATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-811s1c1
Sequence:CCGGGCCATCATGATTGCTCTGATTCTCGAGAATCAGAGCAATCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-428s1c1
Sequence:CCGGCCTGTGCTAATGGATATACAACTCGAGTTGTATATCCATTAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029202.1-291s1c1
Sequence:CCGGCCTTCGAGATAAGCACTTAAACTCGAGTTTAAGTGCTTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019644
ANKRD7 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-474s1c1
Sequence:CCGGCTGATGTGAATGCTTCAGATACTCGAGTATCTGAAGCATTCACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-798s1c1
Sequence:CCGGCCGGTTAAGTGAACTATGATACTCGAGTATCATAGTTCACTTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-851s1c1
Sequence:CCGGGTTTCGTTAATTGGATGGGATCTCGAGATCCCATCCAATTAACGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-582s1c1
Sequence:CCGGGTTACGAAGGTATTGTGGATTCTCGAGAATCCACAATACCTTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-784s1c1
Sequence:CCGGGTACTTTGAAAGAACCGGTTACTCGAGTAACCGGTTCTTTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019644.1-531s1c1
Sequence:CCGGGTGAACCACCATGTTTAGTAACTCGAGTTACTAAACATGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019644
ANKRD7 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-474s1c1
Sequence:CCGGCTGATGTGAATGCTTCAGATACTCGAGTATCTGAAGCATTCACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-798s1c1
Sequence:CCGGCCGGTTAAGTGAACTATGATACTCGAGTATCATAGTTCACTTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-851s1c1
Sequence:CCGGGTTTCGTTAATTGGATGGGATCTCGAGATCCCATCCAATTAACGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-582s1c1
Sequence:CCGGGTTACGAAGGTATTGTGGATTCTCGAGAATCCACAATACCTTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-784s1c1
Sequence:CCGGGTACTTTGAAAGAACCGGTTACTCGAGTAACCGGTTCTTTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019644.1-531s1c1
Sequence:CCGGGTGAACCACCATGTTTAGTAACTCGAGTTACTAAACATGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019644
ANKRD7 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-474s1c1
Sequence:CCGGCTGATGTGAATGCTTCAGATACTCGAGTATCTGAAGCATTCACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-798s1c1
Sequence:CCGGCCGGTTAAGTGAACTATGATACTCGAGTATCATAGTTCACTTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-851s1c1
Sequence:CCGGGTTTCGTTAATTGGATGGGATCTCGAGATCCCATCCAATTAACGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019644.1-582s1c1
Sequence:CCGGGTTACGAAGGTATTGTGGATTCTCGAGAATCCACAATACCTTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019644.1-784s1c1
Sequence:CCGGGTACTTTGAAAGAACCGGTTACTCGAGTAACCGGTTCTTTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019644.1-531s1c1
Sequence:CCGGGTGAACCACCATGTTTAGTAACTCGAGTTACTAAACATGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks