EMAIL THIS PAGE TO A FRIEND

ANKRD9

ankyrin repeat domain 9

56 Gene Product Result for
UniProtKB ID: Q96BM1, A8K753
Gene ID:
Mouse(74251) ankyrin repeat domain 9
Rat(314457) ankyrin repeat domain 9
domestic guinea pig(100733932) ankyrin repeat domain 9
naked mole-rat(101721997) ankyrin repeat domain 9
Zebrafish(492328) ankyrin repeat domain 9
dog(490865) ankyrin repeat domain 9
cow(532402) ankyrin repeat domain 9
chicken(423469) ankyrin repeat domain 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066671 MISSION® esiRNA esiRNA targeting mouse Ankrd9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152326 Rosetta Predictions human pricing
NM_001012112 Rosetta Predictions rat pricing
XM_576103 Rosetta Predictions rat pricing
NM_175207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178199 predicted 900
2 SASI_Hs01_00178197 predicted 956
3 SASI_Hs01_00178198 predicted 943
4 SASI_Hs02_00365921 predicted 883
5 SASI_Hs01_00178200 predicted 1165
6 SASI_Hs01_00178201 predicted 898
7 SASI_Hs01_00178202 predicted 1170
8 SASI_Hs01_00178203 predicted 965
9 SASI_Hs01_00178204 predicted 977
10 SASI_Hs01_00178205 predicted 967
11 SASI_Hs01_00178206 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079554 predicted 464
2 SASI_Rn01_00079555 predicted 470
3 SASI_Rn01_00079556 predicted 1147
4 SASI_Rn01_00079557 predicted 1182
5 SASI_Rn01_00079558 predicted 736
6 SASI_Rn01_00079560 predicted 514
7 SASI_Rn01_00079561 predicted 587
8 SASI_Rn01_00079562 predicted 640
9 SASI_Rn01_00079563 predicted 528
10 SASI_Rn02_00200262 predicted 1182
11 SASI_Rn01_00079559 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128425 predicted 1061
2 SASI_Rn01_00128426 predicted 1099
3 SASI_Rn01_00128427 predicted 660
4 SASI_Rn01_00128428 predicted 809
5 SASI_Rn01_00128429 predicted 505
6 SASI_Rn01_00128430 predicted 561
7 SASI_Rn01_00128431 predicted 451
8 SASI_Rn01_00128432 predicted 857
9 SASI_Rn01_00128433 predicted 1104
10 SASI_Rn01_00128434 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345877 predicted 1489
2 SASI_Mm02_00345878 predicted 1047
3 SASI_Mm01_00129955 predicted 536
4 SASI_Mm01_00129956 predicted 1720
5 SASI_Mm01_00129957 predicted 557
6 SASI_Mm01_00129959 predicted 1638
7 SASI_Mm01_00129960 predicted 1473
8 SASI_Mm01_00129961 predicted 1161
9 SASI_Mm01_00129962 predicted 1651
10 SASI_Mm01_00129963 predicted 772
11 SASI_Mm01_00129954 predicted 1334
12 SASI_Mm01_00129958 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175207
ANKRD9 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-2292s1c1
Sequence:CCGGGCTGTGAAATTCAACCTTTGTCTCGAGACAAAGGTTGAATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-1856s1c1
Sequence:CCGGCTCATCTCACACTGAATCATTCTCGAGAATGATTCAGTGTGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-968s21c1
Sequence:CCGGTTCGAGATGGCAGTGGCTTTACTCGAGTAAAGCCACTGCCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1131s21c1
Sequence:CCGGGCTTGACCTGCTAGTACTGTACTCGAGTACAGTACTAGCAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1288s21c1
Sequence:CCGGCAGGTGTTGGTCACCACTATCCTCGAGGATAGTGGTGACCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1168s21c1
Sequence:CCGGGTAGGTCCAGCTCGATGTGAACTCGAGTTCACATCGAGCTGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175207.4-1725s21c1
Sequence:CCGGTGTGCTGTCAGCCTCATAAATCTCGAGATTTATGAGGCTGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175207
ANKRD9 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-2292s1c1
Sequence:CCGGGCTGTGAAATTCAACCTTTGTCTCGAGACAAAGGTTGAATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-1856s1c1
Sequence:CCGGCTCATCTCACACTGAATCATTCTCGAGAATGATTCAGTGTGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-968s21c1
Sequence:CCGGTTCGAGATGGCAGTGGCTTTACTCGAGTAAAGCCACTGCCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1131s21c1
Sequence:CCGGGCTTGACCTGCTAGTACTGTACTCGAGTACAGTACTAGCAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1288s21c1
Sequence:CCGGCAGGTGTTGGTCACCACTATCCTCGAGGATAGTGGTGACCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1168s21c1
Sequence:CCGGGTAGGTCCAGCTCGATGTGAACTCGAGTTCACATCGAGCTGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175207.4-1725s21c1
Sequence:CCGGTGTGCTGTCAGCCTCATAAATCTCGAGATTTATGAGGCTGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175207
ANKRD9 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-2292s1c1
Sequence:CCGGGCTGTGAAATTCAACCTTTGTCTCGAGACAAAGGTTGAATTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175207.2-1856s1c1
Sequence:CCGGCTCATCTCACACTGAATCATTCTCGAGAATGATTCAGTGTGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-968s21c1
Sequence:CCGGTTCGAGATGGCAGTGGCTTTACTCGAGTAAAGCCACTGCCATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1131s21c1
Sequence:CCGGGCTTGACCTGCTAGTACTGTACTCGAGTACAGTACTAGCAGGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1288s21c1
Sequence:CCGGCAGGTGTTGGTCACCACTATCCTCGAGGATAGTGGTGACCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175207.4-1168s21c1
Sequence:CCGGGTAGGTCCAGCTCGATGTGAACTCGAGTTCACATCGAGCTGGACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175207.4-1725s21c1
Sequence:CCGGTGTGCTGTCAGCCTCATAAATCTCGAGATTTATGAGGCTGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152326
ANKRD9 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-690s21c1
Sequence:CCGGCAAGTCGTCGTTCGCCTTCTACTCGAGTAGAAGGCGAACGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-862s21c1
Sequence:CCGGCATTACCTGCTGGCCACGTTCCTCGAGGAACGTGGCCAGCAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-1382s21c1
Sequence:CCGGTGGGTGAGGACAAGTTCCAGTCTCGAGACTGGAACTTGTCCTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-847s21c1
Sequence:CCGGCACCAAGCGTACGCGCATTACCTCGAGGTAATGCGCGTACGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-735s21c1
Sequence:CCGGCGTGTGGCTGCTGGAGGATATCTCGAGATATCCTCCAGCAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152326
ANKRD9 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-690s21c1
Sequence:CCGGCAAGTCGTCGTTCGCCTTCTACTCGAGTAGAAGGCGAACGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-862s21c1
Sequence:CCGGCATTACCTGCTGGCCACGTTCCTCGAGGAACGTGGCCAGCAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-1382s21c1
Sequence:CCGGTGGGTGAGGACAAGTTCCAGTCTCGAGACTGGAACTTGTCCTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-847s21c1
Sequence:CCGGCACCAAGCGTACGCGCATTACCTCGAGGTAATGCGCGTACGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-735s21c1
Sequence:CCGGCGTGTGGCTGCTGGAGGATATCTCGAGATATCCTCCAGCAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152326
ANKRD9 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-690s21c1
Sequence:CCGGCAAGTCGTCGTTCGCCTTCTACTCGAGTAGAAGGCGAACGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-862s21c1
Sequence:CCGGCATTACCTGCTGGCCACGTTCCTCGAGGAACGTGGCCAGCAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-1382s21c1
Sequence:CCGGTGGGTGAGGACAAGTTCCAGTCTCGAGACTGGAACTTGTCCTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-847s21c1
Sequence:CCGGCACCAAGCGTACGCGCATTACCTCGAGGTAATGCGCGTACGCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152326.2-735s21c1
Sequence:CCGGCGTGTGGCTGCTGGAGGATATCTCGAGATATCCTCCAGCAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks