EMAIL THIS PAGE TO A FRIEND

ANKS1A

ankyrin repeat and sterile alpha motif domain containing 1A

98 Gene Product Result for
Synonyms: ANKS1
UniProtKB ID: Q92625, A2RUC1, Q5JYI9, Q5SYR2, Q86WQ7
Gene ID:
Rat(309639) ankyrin repeat and sterile alpha motif domain containing 1A
naked mole-rat(101726128) ankyrin repeat and sterile alpha motif domain containing 1A
domestic guinea pig(100725942) ankyrin repeat and sterile alpha motif domain containing 1A
sheep(101116686) ankyrin repeat and sterile alpha motif domain containing 1A
Domestic Rabbit(100358267) ankyrin repeat and sterile alpha motif domain containing 1A
chicken(419898) ankyrin repeat and sterile alpha motif domain containing 1A
dog(608187) ankyrin repeat and sterile alpha motif domain containing 1A
cow(532631) ankyrin repeat and sterile alpha motif domain containing 1A
Horse(100062898) ankyrin repeat and sterile alpha motif domain containing 1A
domestic cat(101089518) ankyrin repeat and sterile alpha motif domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015245 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150331 MISSION® esiRNA esiRNA human ANKS1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015245 Rosetta Predictions human pricing
NM_001107613 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347380 predicted 1387
2 SASI_Hs01_00218039 predicted 1217
3 SASI_Hs01_00218040 predicted 1498
4 SASI_Hs01_00218041 predicted 1170
5 SASI_Hs01_00218042 predicted 1484
6 SASI_Hs01_00218043 predicted 3092
7 SASI_Hs01_00218044 predicted 1962
8 SASI_Hs01_00218045 predicted 2997
9 SASI_Hs01_00218046 predicted 2521
10 SASI_Hs01_00218047 predicted 2954
11 SASI_Hs01_00218048 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230555 predicted 517
2 SASI_Rn02_00230556 predicted 2661
3 SASI_Rn02_00230557 predicted 2940
4 SASI_Rn02_00230558 predicted 3358
5 SASI_Rn02_00230559 predicted 3180
6 SASI_Rn02_00230560 predicted 1070
7 SASI_Rn02_00230561 predicted 3292
8 SASI_Rn02_00230562 predicted 3077
9 SASI_Rn02_00230563 predicted 2284
10 SASI_Rn02_00230564 predicted 1974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015245
VALIDATED
ANKS1A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 1A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015245.1-3455s1c1
Sequence:CCGGGATATGGACCAAGATGCCCAACTCGAGTTGGGCATCTTGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015245.1-2508s1c1
Sequence:CCGGCCTTCTTGTCAAGTGGTTACACTCGAGTGTAACCACTTGACAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1024s1c1
Sequence:CCGGCCAGCAAATAGCAGCATTAATCTCGAGATTAATGCTGCTATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1391s1c1
Sequence:CCGGGAGGAAGAAGACCACATAGATCTCGAGATCTATGTGGTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-2138s1c1
Sequence:CCGGGAGTGGGATGAGATTGAGAAACTCGAGTTTCTCAATCTCATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015245.1-5093s1c1
Sequence:CCGGCCTCCACTTCTTGGTACTAAACTCGAGTTTAGTACCAAGAAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-3150s21c1
Sequence:CCGGAGCACGAGATCCGGAACATTTCTCGAGAAATGTTCCGGATCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-949s21c1
Sequence:CCGGAGGAACTGACGTCAACATAAACTCGAGTTTATGTTGACGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-3034s21c1
Sequence:CCGGCTGTGCCAAGATGCGGAAATCCTCGAGGATTTCCGCATCTTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-2961s21c1
Sequence:CCGGGTGGTTATGAAGCCAATTATCCTCGAGGATAATTGGCTTCATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015245.2-3876s21c1
Sequence:CCGGAGGTCATACTGCCAATCTTTACTCGAGTAAAGATTGGCAGTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015245
VALIDATED
ANKS1A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 1A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015245.1-3455s1c1
Sequence:CCGGGATATGGACCAAGATGCCCAACTCGAGTTGGGCATCTTGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015245.1-2508s1c1
Sequence:CCGGCCTTCTTGTCAAGTGGTTACACTCGAGTGTAACCACTTGACAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1024s1c1
Sequence:CCGGCCAGCAAATAGCAGCATTAATCTCGAGATTAATGCTGCTATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1391s1c1
Sequence:CCGGGAGGAAGAAGACCACATAGATCTCGAGATCTATGTGGTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-2138s1c1
Sequence:CCGGGAGTGGGATGAGATTGAGAAACTCGAGTTTCTCAATCTCATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015245.1-5093s1c1
Sequence:CCGGCCTCCACTTCTTGGTACTAAACTCGAGTTTAGTACCAAGAAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-3150s21c1
Sequence:CCGGAGCACGAGATCCGGAACATTTCTCGAGAAATGTTCCGGATCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-949s21c1
Sequence:CCGGAGGAACTGACGTCAACATAAACTCGAGTTTATGTTGACGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-3034s21c1
Sequence:CCGGCTGTGCCAAGATGCGGAAATCCTCGAGGATTTCCGCATCTTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-2961s21c1
Sequence:CCGGGTGGTTATGAAGCCAATTATCCTCGAGGATAATTGGCTTCATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015245.2-3876s21c1
Sequence:CCGGAGGTCATACTGCCAATCTTTACTCGAGTAAAGATTGGCAGTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015245
VALIDATED
ANKS1A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 1A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015245.1-3455s1c1
Sequence:CCGGGATATGGACCAAGATGCCCAACTCGAGTTGGGCATCTTGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015245.1-2508s1c1
Sequence:CCGGCCTTCTTGTCAAGTGGTTACACTCGAGTGTAACCACTTGACAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1024s1c1
Sequence:CCGGCCAGCAAATAGCAGCATTAATCTCGAGATTAATGCTGCTATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-1391s1c1
Sequence:CCGGGAGGAAGAAGACCACATAGATCTCGAGATCTATGTGGTCTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015245.1-2138s1c1
Sequence:CCGGGAGTGGGATGAGATTGAGAAACTCGAGTTTCTCAATCTCATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015245.1-5093s1c1
Sequence:CCGGCCTCCACTTCTTGGTACTAAACTCGAGTTTAGTACCAAGAAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-3150s21c1
Sequence:CCGGAGCACGAGATCCGGAACATTTCTCGAGAAATGTTCCGGATCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-949s21c1
Sequence:CCGGAGGAACTGACGTCAACATAAACTCGAGTTTATGTTGACGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015245.2-3034s21c1
Sequence:CCGGCTGTGCCAAGATGCGGAAATCCTCGAGGATTTCCGCATCTTGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015245.2-2961s21c1
Sequence:CCGGGTGGTTATGAAGCCAATTATCCTCGAGGATAATTGGCTTCATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015245.2-3876s21c1
Sequence:CCGGAGGTCATACTGCCAATCTTTACTCGAGTAAAGATTGGCAGTATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks