EMAIL THIS PAGE TO A FRIEND

ANKS1B

ankyrin repeat and sterile alpha motif domain containing 1B

328 Gene Product Result for
Synonyms: AIDA AIDA-1 ANKS2 EB-1 EB1 cajalin-2
Gene ID:
Human(56899) Summary: This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(77531) ankyrin repeat and sterile alpha motif domain containing 1B
Rat(314721) ankyrin repeat and sterile alpha motif domain containing 1B
Zebrafish(565408) ankyrin repeat and sterile alpha motif domain containing 1B
dog(482621) ankyrin repeat and sterile alpha motif domain containing 1B
Horse(100052606) ankyrin repeat and sterile alpha motif domain containing 1B
cow(615777) ankyrin repeat and sterile alpha motif domain containing 1B
domestic cat(101086662) ankyrin repeat and sterile alpha motif domain containing 1B
chicken(417927) ankyrin repeat and sterile alpha motif domain containing 1B
sheep(101102891) ankyrin repeat and sterile alpha motif domain containing 1B
domestic guinea pig(100717398) ankyrin repeat and sterile alpha motif domain containing 1B
naked mole-rat(101718653) ankyrin repeat and sterile alpha motif domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301499 ANTI-ANKS1B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0086 AQUA Peptide KVPTIILSVSY[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020140 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020140 Rosetta Predictions human pricing
NM_152788 Rosetta Predictions human pricing
NM_181670 Rosetta Predictions human pricing
XM_001076955 Rosetta Predictions rat pricing
XM_235052 Rosetta Predictions rat pricing
NM_001128086 Rosetta Predictions mouse pricing
XM_001003394 Rosetta Predictions mouse pricing
XM_001003400 Rosetta Predictions mouse pricing
XM_001003405 Rosetta Predictions mouse pricing
XM_001003410 Rosetta Predictions mouse pricing
XM_001003416 Rosetta Predictions mouse pricing
XM_001003423 Rosetta Predictions mouse pricing
XM_001003427 Rosetta Predictions mouse pricing
XM_001003432 Rosetta Predictions mouse pricing
XM_001003434 Rosetta Predictions mouse pricing
XM_001003440 Rosetta Predictions mouse pricing
XM_001003446 Rosetta Predictions mouse pricing
XM_001003455 Rosetta Predictions mouse pricing
XM_917405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227329 predicted 1072
2 SASI_Hs01_00227331 predicted 1116
3 SASI_Hs02_00353024 predicted 1125
4 SASI_Hs01_00227332 predicted 1109
5 SASI_Hs01_00227333 predicted 1024
6 SASI_Hs01_00227334 predicted 535
7 SASI_Hs01_00227335 predicted 961
8 SASI_Hs02_00353025 predicted 1005
9 SASI_Hs02_00353026 predicted 1030
10 SASI_Hs02_00353027 predicted 971
11 SASI_Hs01_00227330 predicted 1118
12 SASI_Hs01_00227336 predicted 1121
13 SASI_Hs01_00227337 predicted 1071
14 SASI_Hs01_00227338 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211329 predicted 3791
2 SASI_Hs01_00211331 predicted 3833
3 SASI_Hs02_00366732 predicted 3846
4 SASI_Hs01_00211332 predicted 3824
5 SASI_Hs01_00211333 predicted 3743
6 SASI_Hs01_00211334 predicted 3075
7 SASI_Hs01_00211335 predicted 3679
8 SASI_Hs02_00366733 predicted 3724
9 SASI_Hs02_00366734 predicted 3751
10 SASI_Hs02_00366735 predicted 3683
11 SASI_Hs01_00211330 predicted 3837
12 SASI_Hs01_00211336 predicted 3830
13 SASI_Hs01_00211337 predicted 3788
14 SASI_Hs01_00211338 predicted 3742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012401 predicted 1328
2 SASI_Hs01_00012403 predicted 1371
3 SASI_Hs02_00370257 predicted 1380
4 SASI_Hs01_00012404 predicted 1361
5 SASI_Hs01_00012405 predicted 1278
6 SASI_Hs01_00012406 predicted 534
7 SASI_Hs01_00012407 predicted 1217
8 SASI_Hs02_00370258 predicted 1259
9 SASI_Hs02_00370259 predicted 1284
10 SASI_Hs02_00370260 predicted 1221
11 SASI_Hs01_00012402 predicted 1369
12 SASI_Hs01_00012408 predicted 1374
13 SASI_Hs01_00012409 predicted 1315
14 SASI_Hs01_00012410 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355172 predicted 211
2 SASI_Rn02_00355173 predicted 3319
3 SASI_Rn02_00355174 predicted 315
4 SASI_Rn02_00355175 predicted 2223
5 SASI_Rn02_00355176 predicted 1590
6 SASI_Rn02_00355177 predicted 1942
7 SASI_Rn02_00355178 predicted 2494
8 SASI_Rn02_00355179 predicted 3413
9 SASI_Rn02_00355180 predicted 775
10 SASI_Rn02_00355181 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169983 predicted 1378
2 SASI_Rn01_00169984 predicted 3651
3 SASI_Rn01_00169985 predicted 3605
4 SASI_Rn01_00169986 predicted 647
5 SASI_Rn01_00169987 predicted 2508
6 SASI_Rn01_00169988 predicted 1872
7 SASI_Rn01_00169989 predicted 2223
8 SASI_Rn01_00169990 predicted 1103
9 SASI_Rn01_00169991 predicted 1562
10 SASI_Rn01_00169992 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310458 predicted 565
2 SASI_Mm02_00310459 predicted 2514
3 SASI_Mm02_00310460 predicted 3530
4 SASI_Mm02_00310461 predicted 2656
5 SASI_Mm02_00310462 predicted 2985
6 SASI_Mm02_00310463 predicted 898
7 SASI_Mm02_00310464 predicted 1631
8 SASI_Mm02_00310465 predicted 369
9 SASI_Mm02_00310466 predicted 1207
10 SASI_Mm02_00310467 predicted 3081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207678 predicted 1049
2 SASI_Mm01_00207679 predicted 1195
3 SASI_Mm01_00207680 predicted 1393
4 SASI_Mm01_00207681 predicted 1396
5 SASI_Mm01_00207682 predicted 1417
6 SASI_Mm01_00207683 predicted 847
7 SASI_Mm01_00207684 predicted 1693
8 SASI_Mm01_00207685 predicted 1475
9 SASI_Mm01_00207686 predicted 1792
10 SASI_Mm01_00207687 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251541 predicted 4653
2 SASI_Mm01_00251542 predicted 4689
3 SASI_Mm01_00251543 predicted 4571
4 SASI_Mm01_00251544 predicted 4657
5 SASI_Mm01_00251545 predicted 4579
6 SASI_Mm01_00251546 predicted 4656
7 SASI_Mm01_00251547 predicted 4651
8 SASI_Mm01_00251548 predicted 4582
9 SASI_Mm01_00251549 predicted 4560
10 SASI_Mm01_00251550 predicted 4578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224407 predicted 458
2 SASI_Mm01_00224408 predicted 435
3 SASI_Mm01_00224409 predicted 450
4 SASI_Mm01_00224410 predicted 440
5 SASI_Mm01_00224411 predicted 431
6 SASI_Mm01_00224412 predicted 463
7 SASI_Mm01_00224413 predicted 450
8 SASI_Mm01_00224414 predicted 431
9 SASI_Mm01_00224415 predicted 427
10 SASI_Mm01_00224416 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254402 predicted 757
2 SASI_Mm01_00254403 predicted 1412
3 SASI_Mm01_00254404 predicted 565
4 SASI_Mm01_00254405 predicted 1457
5 SASI_Mm01_00254406 predicted 1219
6 SASI_Mm01_00254407 predicted 892
7 SASI_Mm01_00254408 predicted 849
8 SASI_Mm01_00254409 predicted 1470
9 SASI_Mm01_00254410 predicted 1593
10 SASI_Mm01_00254411 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206399 predicted 1440
2 SASI_Mm01_00206400 predicted 1474
3 SASI_Mm01_00206401 predicted 1483
4 SASI_Mm01_00206402 predicted 891
5 SASI_Mm01_00206403 predicted 1177
6 SASI_Mm01_00206404 predicted 789
7 SASI_Mm01_00206405 predicted 1416
8 SASI_Mm01_00206406 predicted 1192
9 SASI_Mm01_00206407 predicted 989
10 SASI_Mm01_00206408 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228389 predicted 719
2 SASI_Mm01_00228390 predicted 758
3 SASI_Mm01_00228391 predicted 509
4 SASI_Mm01_00228392 predicted 760
5 SASI_Mm01_00228393 predicted 459
6 SASI_Mm01_00228394 predicted 774
7 SASI_Mm01_00228395 predicted 758
8 SASI_Mm01_00228396 predicted 644
9 SASI_Mm01_00228397 predicted 694
10 SASI_Mm01_00228398 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217043 predicted 376
2 SASI_Mm01_00217044 predicted 633
3 SASI_Mm01_00217045 predicted 401
4 SASI_Mm01_00217046 predicted 839
5 SASI_Mm01_00217047 predicted 2883
6 SASI_Mm01_00217048 predicted 1623
7 SASI_Mm01_00217049 predicted 1824
8 SASI_Mm01_00217050 predicted 1650
9 SASI_Mm01_00217051 predicted 3748
10 SASI_Mm01_00217052 predicted 2339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264427 predicted 688
2 SASI_Mm01_00264428 predicted 1335
3 SASI_Mm01_00264429 predicted 1328
4 SASI_Mm01_00264430 predicted 1378
5 SASI_Mm01_00264431 predicted 1385
6 SASI_Mm01_00264432 predicted 1275
7 SASI_Mm01_00264433 predicted 1329
8 SASI_Mm01_00264434 predicted 1375
9 SASI_Mm01_00264435 predicted 1264
10 SASI_Mm01_00264436 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252419 predicted 1513
2 SASI_Mm01_00252420 predicted 788
3 SASI_Mm01_00252421 predicted 1546
4 SASI_Mm01_00252422 predicted 1561
5 SASI_Mm01_00252423 predicted 892
6 SASI_Mm01_00252424 predicted 1453
7 SASI_Mm01_00252425 predicted 744
8 SASI_Mm01_00252426 predicted 817
9 SASI_Mm01_00252427 predicted 1393
10 SASI_Mm01_00252428 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265626 predicted 689
2 SASI_Mm01_00265627 predicted 1258
3 SASI_Mm01_00265628 predicted 1254
4 SASI_Mm01_00265629 predicted 1296
5 SASI_Mm01_00265630 predicted 1194
6 SASI_Mm01_00265631 predicted 1260
7 SASI_Mm01_00265632 predicted 1298
8 SASI_Mm01_00265633 predicted 1186
9 SASI_Mm01_00265634 predicted 1193
10 SASI_Mm01_00265635 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281352 predicted 286
2 SASI_Mm01_00281353 predicted 969
3 SASI_Mm01_00281354 predicted 1010
4 SASI_Mm01_00281355 predicted 769
5 SASI_Mm01_00281356 predicted 420
6 SASI_Mm01_00281357 predicted 382
7 SASI_Mm01_00281358 predicted 1018
8 SASI_Mm01_00281359 predicted 283
9 SASI_Mm01_00281360 predicted 517
10 SASI_Mm01_00281361 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204053 predicted 1441
2 SASI_Mm01_00204054 predicted 1479
3 SASI_Mm01_00204055 predicted 1481
4 SASI_Mm01_00204056 predicted 887
5 SASI_Mm01_00204057 predicted 1182
6 SASI_Mm01_00204058 predicted 793
7 SASI_Mm01_00204059 predicted 1416
8 SASI_Mm01_00204060 predicted 1192
9 SASI_Mm01_00204061 predicted 983
10 SASI_Mm01_00204062 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441146 predicted 566
2 SASI_Mm02_00441147 predicted 2517
3 SASI_Mm02_00441148 predicted 3535
4 SASI_Mm02_00441149 predicted 2662
5 SASI_Mm02_00441150 predicted 2990
6 SASI_Mm02_00441151 predicted 901
7 SASI_Mm02_00441152 predicted 1632
8 SASI_Mm02_00441153 predicted 363
9 SASI_Mm02_00441154 predicted 1204
10 SASI_Mm02_00441155 predicted 3083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128086
ANKS1B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-333s21c1
Sequence:CCGGGTTCGGGTTACACCGCTTTACCTCGAGGTAAAGCGGTGTAACCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128086.1-5638s21c1
Sequence:CCGGGCGTGGGCTTCCAGTTATAAACTCGAGTTTATAACTGGAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3537s21c1
Sequence:CCGGCCGAACATGAAATTCGTAATACTCGAGTATTACGAATTTCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-907s21c1
Sequence:CCGGAGGAATTGATGCCAACATAAACTCGAGTTTATGTTGGCATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3505s21c1
Sequence:CCGGATTTATCGATGCGGCAAATAACTCGAGTTATTTGCCGCATCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128086
ANKS1B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-333s21c1
Sequence:CCGGGTTCGGGTTACACCGCTTTACCTCGAGGTAAAGCGGTGTAACCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128086.1-5638s21c1
Sequence:CCGGGCGTGGGCTTCCAGTTATAAACTCGAGTTTATAACTGGAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3537s21c1
Sequence:CCGGCCGAACATGAAATTCGTAATACTCGAGTATTACGAATTTCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-907s21c1
Sequence:CCGGAGGAATTGATGCCAACATAAACTCGAGTTTATGTTGGCATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3505s21c1
Sequence:CCGGATTTATCGATGCGGCAAATAACTCGAGTTATTTGCCGCATCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128086
ANKS1B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-333s21c1
Sequence:CCGGGTTCGGGTTACACCGCTTTACCTCGAGGTAAAGCGGTGTAACCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128086.1-5638s21c1
Sequence:CCGGGCGTGGGCTTCCAGTTATAAACTCGAGTTTATAACTGGAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3537s21c1
Sequence:CCGGCCGAACATGAAATTCGTAATACTCGAGTATTACGAATTTCATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-907s21c1
Sequence:CCGGAGGAATTGATGCCAACATAAACTCGAGTTTATGTTGGCATCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128086.1-3505s21c1
Sequence:CCGGATTTATCGATGCGGCAAATAACTCGAGTTATTTGCCGCATCGATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020140
ANKS1B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 1B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1078s21c1
Sequence:CCGGTGAGCATGAAATTCGTAATATCTCGAGATATTACGAATTTCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-996s21c1
Sequence:CCGGTGAAGAAGGTCCCTACTATTACTCGAGTAATAGTAGGGACCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-678s21c1
Sequence:CCGGTTGGCCACAGGAAACGTATTTCTCGAGAAATACGTTTCCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020140.2-1465s21c1
Sequence:CCGGATAGCTGATAAAGCCTAAATACTCGAGTATTTAGGCTTTATCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1127s21c1
Sequence:CCGGCTCTCAACATTTGCCTATATCCTCGAGGATATAGGCAAATGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020140.1-912s1c1
Sequence:CCGGGTCGTGTGATTACAAAGCTTTCTCGAGAAAGCTTTGTAATCACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020140
ANKS1B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 1B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1078s21c1
Sequence:CCGGTGAGCATGAAATTCGTAATATCTCGAGATATTACGAATTTCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-996s21c1
Sequence:CCGGTGAAGAAGGTCCCTACTATTACTCGAGTAATAGTAGGGACCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-678s21c1
Sequence:CCGGTTGGCCACAGGAAACGTATTTCTCGAGAAATACGTTTCCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020140.2-1465s21c1
Sequence:CCGGATAGCTGATAAAGCCTAAATACTCGAGTATTTAGGCTTTATCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1127s21c1
Sequence:CCGGCTCTCAACATTTGCCTATATCCTCGAGGATATAGGCAAATGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020140.1-912s1c1
Sequence:CCGGGTCGTGTGATTACAAAGCTTTCTCGAGAAAGCTTTGTAATCACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020140
ANKS1B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 1B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1078s21c1
Sequence:CCGGTGAGCATGAAATTCGTAATATCTCGAGATATTACGAATTTCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-996s21c1
Sequence:CCGGTGAAGAAGGTCCCTACTATTACTCGAGTAATAGTAGGGACCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-678s21c1
Sequence:CCGGTTGGCCACAGGAAACGTATTTCTCGAGAAATACGTTTCCTGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020140.2-1465s21c1
Sequence:CCGGATAGCTGATAAAGCCTAAATACTCGAGTATTTAGGCTTTATCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020140.2-1127s21c1
Sequence:CCGGCTCTCAACATTTGCCTATATCCTCGAGGATATAGGCAAATGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020140.1-912s1c1
Sequence:CCGGGTCGTGTGATTACAAAGCTTTCTCGAGAAAGCTTTGTAATCACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks