EMAIL THIS PAGE TO A FRIEND

ANKS3

ankyrin repeat and sterile alpha motif domain containing 3

49 Gene Product Result for
UniProtKB ID: Q6ZW76, B4DWU4, D3DUE2, Q8TF25
Gene ID:
Mouse(72615) ankyrin repeat and sterile alpha motif domain containing 3
Rat(302937) ankyrin repeat and sterile alpha motif domain containing 3
naked mole-rat(101696709) ankyrin repeat and sterile alpha motif domain containing 3
domestic guinea pig(100721368) ankyrin repeat and sterile alpha motif domain containing 3
sheep(101103287) ankyrin repeat and sterile alpha motif domain containing 3
chicken(769431) ankyrin repeat and sterile alpha motif domain containing 3
cow(528545) ankyrin repeat and sterile alpha motif domain containing 3
domestic cat(101093232) ankyrin repeat and sterile alpha motif domain containing 3
Horse(100066145) ankyrin repeat and sterile alpha motif domain containing 3
dog(490024) ankyrin repeat and sterile alpha motif domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133450 Rosetta Predictions human pricing
NM_001009676 Rosetta Predictions rat pricing
NM_028301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117498 predicted 645
2 SASI_Hs01_00117499 predicted 1731
3 SASI_Hs01_00117501 predicted 628
4 SASI_Hs01_00117502 predicted 787
5 SASI_Hs01_00117503 predicted 1595
6 SASI_Hs01_00117504 predicted 2273
7 SASI_Hs01_00117505 predicted 2287
8 SASI_Hs01_00117506 predicted 2258
9 SASI_Hs01_00117507 predicted 830
10 SASI_Hs02_00363130 predicted 738
11 SASI_Hs01_00117500 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056019 predicted 694
2 SASI_Rn01_00056020 predicted 694
3 SASI_Rn01_00056021 predicted 589
4 SASI_Rn01_00056022 predicted 276
5 SASI_Rn01_00056023 predicted 2044
6 SASI_Rn01_00056024 predicted 2019
7 SASI_Rn01_00056025 predicted 1384
8 SASI_Rn01_00056026 predicted 1190
9 SASI_Rn01_00056027 predicted 382
10 SASI_Rn01_00056028 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062095 predicted 662
2 SASI_Mm01_00062096 predicted 313
3 SASI_Mm01_00062097 predicted 1205
4 SASI_Mm01_00062098 predicted 349
5 SASI_Mm01_00062099 predicted 2124
6 SASI_Mm01_00062100 predicted 327
7 SASI_Mm01_00062101 predicted 2095
8 SASI_Mm01_00062103 predicted 2026
9 SASI_Mm02_00333651 predicted 2017
10 SASI_Mm02_00333652 predicted 358
11 SASI_Mm01_00062102 predicted 712
12 SASI_Mm01_00062104 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133450
ANKS3 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1688s1c1
Sequence:CCGGGAAGGAAATTGGCATCACGCTCTCGAGAGCGTGATGCCAATTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1677s1c1
Sequence:CCGGGAGAGCGACCTGAAGGAAATTCTCGAGAATTTCCTTCAGGTCGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-639s1c1
Sequence:CCGGGAGAGCATCGCCTACTTTCTTCTCGAGAAGAAAGTAGGCGATGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-677s1c1
Sequence:CCGGGCTAGAAATGAAAGACATCCACTCGAGTGGATGTCTTTCATTTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-836s1c1
Sequence:CCGGCCATGAGATAATCGTGCAGTACTCGAGTACTGCACGATTATCTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-464s1c1
Sequence:CCGGGCGGAGAGAGTTAGATTTGAACTCGAGTTCAAATCTAACTCTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-423s1c1
Sequence:CCGGGCTTCCATTGGCCAGTATGAACTCGAGTTCATACTGGCCAATGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1416s1c1
Sequence:CCGGGACTCGGATCATGCCTGTAAACTCGAGTTTACAGGCATGATCCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1682s1c1
Sequence:CCGGCGACCTGAAGGAAATTGGCATCTCGAGATGCCAATTTCCTTCAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1658s1c1
Sequence:CCGGCATCTTTCTGACCCTCACTGACTCGAGTCAGTGAGGGTCAGAAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-835s1c1
Sequence:CCGGGCCATGAGATAATCGTGCAGTCTCGAGACTGCACGATTATCTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133450.1-2277s1c1
Sequence:CCGGCGAATCTGACGTTGGGTGATTCTCGAGAATCACCCAACGTCAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133450
ANKS3 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1688s1c1
Sequence:CCGGGAAGGAAATTGGCATCACGCTCTCGAGAGCGTGATGCCAATTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1677s1c1
Sequence:CCGGGAGAGCGACCTGAAGGAAATTCTCGAGAATTTCCTTCAGGTCGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-639s1c1
Sequence:CCGGGAGAGCATCGCCTACTTTCTTCTCGAGAAGAAAGTAGGCGATGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-677s1c1
Sequence:CCGGGCTAGAAATGAAAGACATCCACTCGAGTGGATGTCTTTCATTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-836s1c1
Sequence:CCGGCCATGAGATAATCGTGCAGTACTCGAGTACTGCACGATTATCTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-464s1c1
Sequence:CCGGGCGGAGAGAGTTAGATTTGAACTCGAGTTCAAATCTAACTCTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-423s1c1
Sequence:CCGGGCTTCCATTGGCCAGTATGAACTCGAGTTCATACTGGCCAATGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1416s1c1
Sequence:CCGGGACTCGGATCATGCCTGTAAACTCGAGTTTACAGGCATGATCCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1682s1c1
Sequence:CCGGCGACCTGAAGGAAATTGGCATCTCGAGATGCCAATTTCCTTCAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1658s1c1
Sequence:CCGGCATCTTTCTGACCCTCACTGACTCGAGTCAGTGAGGGTCAGAAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-835s1c1
Sequence:CCGGGCCATGAGATAATCGTGCAGTCTCGAGACTGCACGATTATCTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133450.1-2277s1c1
Sequence:CCGGCGAATCTGACGTTGGGTGATTCTCGAGAATCACCCAACGTCAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133450
ANKS3 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1688s1c1
Sequence:CCGGGAAGGAAATTGGCATCACGCTCTCGAGAGCGTGATGCCAATTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1677s1c1
Sequence:CCGGGAGAGCGACCTGAAGGAAATTCTCGAGAATTTCCTTCAGGTCGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-639s1c1
Sequence:CCGGGAGAGCATCGCCTACTTTCTTCTCGAGAAGAAAGTAGGCGATGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-677s1c1
Sequence:CCGGGCTAGAAATGAAAGACATCCACTCGAGTGGATGTCTTTCATTTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-836s1c1
Sequence:CCGGCCATGAGATAATCGTGCAGTACTCGAGTACTGCACGATTATCTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-464s1c1
Sequence:CCGGGCGGAGAGAGTTAGATTTGAACTCGAGTTCAAATCTAACTCTCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-423s1c1
Sequence:CCGGGCTTCCATTGGCCAGTATGAACTCGAGTTCATACTGGCCAATGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133450.1-1416s1c1
Sequence:CCGGGACTCGGATCATGCCTGTAAACTCGAGTTTACAGGCATGATCCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1682s1c1
Sequence:CCGGCGACCTGAAGGAAATTGGCATCTCGAGATGCCAATTTCCTTCAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-1658s1c1
Sequence:CCGGCATCTTTCTGACCCTCACTGACTCGAGTCAGTGAGGGTCAGAAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133450.1-835s1c1
Sequence:CCGGGCCATGAGATAATCGTGCAGTCTCGAGACTGCACGATTATCTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133450.1-2277s1c1
Sequence:CCGGCGAATCTGACGTTGGGTGATTCTCGAGAATCACCCAACGTCAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028301
VALIDATED
ANKS3 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-2128s1c1
Sequence:CCGGCCCAGGGAATAGAAGACCATTCTCGAGAATGGTCTTCTATTCCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-1858s1c1
Sequence:CCGGCCACACTTTCTCTCAGCAGATCTCGAGATCTGCTGAGAGAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-507s1c1
Sequence:CCGGCCACCAACAGATGGTCAAATTCTCGAGAATTTGACCATCTGTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-609s1c1
Sequence:CCGGCCATGAGATAATTGTGCAGTACTCGAGTACTGCACAATTATCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-296s1c1
Sequence:CCGGCCTCCTACATTGGACACGATACTCGAGTATCGTGTCCAATGTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1649s21c1
Sequence:CCGGTTGCCATTCAGTTGCATAAATCTCGAGATTTATGCAACTGAATGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1488s21c1
Sequence:CCGGGACTCTCACTGAAAGCGATTTCTCGAGAAATCGCTTTCAGTGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-557s21c1
Sequence:CCGGGCCACCAACAGATGGTCAAATCTCGAGATTTGACCATCTGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1305s21c1
Sequence:CCGGCGGCAACAGTGATGGTCATTGCTCGAGCAATGACCATCACTGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028301.3-2102s21c1
Sequence:CCGGTTCTGACGTTGGGTGATAAATCTCGAGATTTATCACCCAACGTCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028301
VALIDATED
ANKS3 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-2128s1c1
Sequence:CCGGCCCAGGGAATAGAAGACCATTCTCGAGAATGGTCTTCTATTCCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-1858s1c1
Sequence:CCGGCCACACTTTCTCTCAGCAGATCTCGAGATCTGCTGAGAGAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-507s1c1
Sequence:CCGGCCACCAACAGATGGTCAAATTCTCGAGAATTTGACCATCTGTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-609s1c1
Sequence:CCGGCCATGAGATAATTGTGCAGTACTCGAGTACTGCACAATTATCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-296s1c1
Sequence:CCGGCCTCCTACATTGGACACGATACTCGAGTATCGTGTCCAATGTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1649s21c1
Sequence:CCGGTTGCCATTCAGTTGCATAAATCTCGAGATTTATGCAACTGAATGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1488s21c1
Sequence:CCGGGACTCTCACTGAAAGCGATTTCTCGAGAAATCGCTTTCAGTGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-557s21c1
Sequence:CCGGGCCACCAACAGATGGTCAAATCTCGAGATTTGACCATCTGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1305s21c1
Sequence:CCGGCGGCAACAGTGATGGTCATTGCTCGAGCAATGACCATCACTGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028301.3-2102s21c1
Sequence:CCGGTTCTGACGTTGGGTGATAAATCTCGAGATTTATCACCCAACGTCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028301
VALIDATED
ANKS3 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-2128s1c1
Sequence:CCGGCCCAGGGAATAGAAGACCATTCTCGAGAATGGTCTTCTATTCCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-1858s1c1
Sequence:CCGGCCACACTTTCTCTCAGCAGATCTCGAGATCTGCTGAGAGAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028301.1-507s1c1
Sequence:CCGGCCACCAACAGATGGTCAAATTCTCGAGAATTTGACCATCTGTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-609s1c1
Sequence:CCGGCCATGAGATAATTGTGCAGTACTCGAGTACTGCACAATTATCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028301.1-296s1c1
Sequence:CCGGCCTCCTACATTGGACACGATACTCGAGTATCGTGTCCAATGTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1649s21c1
Sequence:CCGGTTGCCATTCAGTTGCATAAATCTCGAGATTTATGCAACTGAATGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1488s21c1
Sequence:CCGGGACTCTCACTGAAAGCGATTTCTCGAGAAATCGCTTTCAGTGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-557s21c1
Sequence:CCGGGCCACCAACAGATGGTCAAATCTCGAGATTTGACCATCTGTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028301.3-1305s21c1
Sequence:CCGGCGGCAACAGTGATGGTCATTGCTCGAGCAATGACCATCACTGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028301.3-2102s21c1
Sequence:CCGGTTCTGACGTTGGGTGATAAATCTCGAGATTTATCACCCAACGTCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)