EMAIL THIS PAGE TO A FRIEND

ANKS4B

ankyrin repeat and sterile alpha motif domain containing 4B

46 Gene Product Result for
Synonyms: HARP
UniProtKB ID: Q8N8V4
Gene ID:
Mouse(72074) ankyrin repeat and sterile alpha motif domain containing 4B
Rat(687561) ankyrin repeat and sterile alpha motif domain containing 4B
Zebrafish(431735) ankyrin repeat and sterile alpha motif domain containing 4B
cow(505168) ankyrin repeat and sterile alpha motif domain containing 4B
Horse(100057947) ankyrin repeat and sterile alpha motif domain containing 4B
domestic cat(101081017) ankyrin repeat and sterile alpha motif domain containing 4B
dog(489980) ankyrin repeat and sterile alpha motif domain containing 4B
chicken(427007) ankyrin repeat and sterile alpha motif domain containing 4B
Goat(100861335) ankyrin repeat and sterile alpha motif domain containing 4B
sheep(101102029) ankyrin repeat and sterile alpha motif domain containing 4B
domestic guinea pig(100717412) ankyrin repeat and sterile alpha motif domain containing 4B
naked mole-rat(101706524) ankyrin repeat and sterile alpha motif domain containing 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145865 Rosetta Predictions human pricing
NM_001127650 Rosetta Predictions rat pricing
NM_028085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210783 predicted 1114
2 SASI_Hs01_00210784 predicted 639
3 SASI_Hs02_00365394 predicted 632
4 SASI_Hs01_00210785 predicted 820
5 SASI_Hs01_00210786 predicted 236
6 SASI_Hs02_00365395 predicted 937
7 SASI_Hs01_00210787 predicted 1135
8 SASI_Hs01_00210788 predicted 888
9 SASI_Hs01_00210789 predicted 278
10 SASI_Hs01_00210790 predicted 303
11 SASI_Hs01_00210791 predicted 628
12 SASI_Hs01_00210792 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254750 predicted 1561
2 SASI_Rn02_00254751 predicted 1490
3 SASI_Rn02_00254752 predicted 1191
4 SASI_Rn02_00254753 predicted 415
5 SASI_Rn02_00254754 predicted 592
6 SASI_Rn02_00254755 predicted 467
7 SASI_Rn02_00254756 predicted 1539
8 SASI_Rn02_00254757 predicted 646
9 SASI_Rn02_00254758 predicted 611
10 SASI_Rn02_00254759 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165604 predicted 309
2 SASI_Mm01_00165605 predicted 633
3 SASI_Mm01_00165607 predicted 554
4 SASI_Mm01_00165608 predicted 1307
5 SASI_Mm01_00165609 predicted 268
6 SASI_Mm02_00333321 predicted 632
7 SASI_Mm01_00165611 predicted 1311
8 SASI_Mm01_00165612 predicted 741
9 SASI_Mm02_00333322 predicted 1235
10 SASI_Mm02_00333323 predicted 1303
11 SASI_Mm01_00165606 predicted 488
12 SASI_Mm01_00165610 predicted 761
13 SASI_Mm01_00165613 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028085
VALIDATED
ANKS4B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 4B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028085.2-1315s21c1
Sequence:CCGGGGTTGACACCAGCCTCTAATGCTCGAGCATTAGAGGCTGGTGTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028085.2-1817s21c1
Sequence:CCGGTAAGGTTGAATGAGGTTATAACTCGAGTTATAACCTCATTCAACCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028085.1-1604s1c1
Sequence:CCGGCCCAACTTAATGGATCATTTACTCGAGTAAATGATCCATTAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-846s1c1
Sequence:CCGGCGGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-183s1c1
Sequence:CCGGCCCTAGAAATAATCTGCAGTACTCGAGTACTGCAGATTATTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-1032s1c1
Sequence:CCGGGCACTGAAGGTGATCTTCCTTCTCGAGAAGGAAGATCACCTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-845s1c1
Sequence:CCGGCCGGGTCTAGGAAGTATTGTTCTCGAGAACAATACTTCCTAGACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028085
VALIDATED
ANKS4B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 4B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028085.2-1315s21c1
Sequence:CCGGGGTTGACACCAGCCTCTAATGCTCGAGCATTAGAGGCTGGTGTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028085.2-1817s21c1
Sequence:CCGGTAAGGTTGAATGAGGTTATAACTCGAGTTATAACCTCATTCAACCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028085.1-1604s1c1
Sequence:CCGGCCCAACTTAATGGATCATTTACTCGAGTAAATGATCCATTAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-846s1c1
Sequence:CCGGCGGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-183s1c1
Sequence:CCGGCCCTAGAAATAATCTGCAGTACTCGAGTACTGCAGATTATTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-1032s1c1
Sequence:CCGGGCACTGAAGGTGATCTTCCTTCTCGAGAAGGAAGATCACCTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-845s1c1
Sequence:CCGGCCGGGTCTAGGAAGTATTGTTCTCGAGAACAATACTTCCTAGACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028085
VALIDATED
ANKS4B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 4B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028085.2-1315s21c1
Sequence:CCGGGGTTGACACCAGCCTCTAATGCTCGAGCATTAGAGGCTGGTGTCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028085.2-1817s21c1
Sequence:CCGGTAAGGTTGAATGAGGTTATAACTCGAGTTATAACCTCATTCAACCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028085.1-1604s1c1
Sequence:CCGGCCCAACTTAATGGATCATTTACTCGAGTAAATGATCCATTAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-846s1c1
Sequence:CCGGCGGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-183s1c1
Sequence:CCGGCCCTAGAAATAATCTGCAGTACTCGAGTACTGCAGATTATTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-1032s1c1
Sequence:CCGGGCACTGAAGGTGATCTTCCTTCTCGAGAAGGAAGATCACCTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028085.1-845s1c1
Sequence:CCGGCCGGGTCTAGGAAGTATTGTTCTCGAGAACAATACTTCCTAGACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145865
ANKS4B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 4B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-628s1c1
Sequence:CCGGGTCACTATCTAAGGGCATTAACTCGAGTTAATGCCCTTAGATAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-849s1c1
Sequence:CCGGCAGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-370s1c1
Sequence:CCGGGCAGAATGAATGTGTTGCTCTCTCGAGAGAGCAACACATTCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-309s1c1
Sequence:CCGGCCAACATCTTTGCCCTGGATACTCGAGTATCCAGGGCAAAGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-283s1c1
Sequence:CCGGCGTCTCATTCCTGGTCAACTTCTCGAGAAGTTGACCAGGAATGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145865.1-2012s1c1
Sequence:CCGGCGATCTGTGTAACCTGGGAATCTCGAGATTCCCAGGTTACACAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-935s1c1
Sequence:CCGGCTGCCCAGTGAATTGCTTCAACTCGAGTTGAAGCAATTCACTGGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-1123s1c1
Sequence:CCGGCCTGCCTATCTTCAAGAGAGACTCGAGTCTCTCTTGAAGATAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-724s1c1
Sequence:CCGGGAGGAACGTGATGGAAGTGTTCTCGAGAACACTTCCATCACGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-823s1c1
Sequence:CCGGGCACCATGAATCCATTCTCAACTCGAGTTGAGAATGGATTCATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-183s1c1
Sequence:CCGGCCCTAGAGATAATCTGCAGTACTCGAGTACTGCAGATTATCTCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145865
ANKS4B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 4B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-628s1c1
Sequence:CCGGGTCACTATCTAAGGGCATTAACTCGAGTTAATGCCCTTAGATAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-849s1c1
Sequence:CCGGCAGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-370s1c1
Sequence:CCGGGCAGAATGAATGTGTTGCTCTCTCGAGAGAGCAACACATTCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-309s1c1
Sequence:CCGGCCAACATCTTTGCCCTGGATACTCGAGTATCCAGGGCAAAGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-283s1c1
Sequence:CCGGCGTCTCATTCCTGGTCAACTTCTCGAGAAGTTGACCAGGAATGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145865.1-2012s1c1
Sequence:CCGGCGATCTGTGTAACCTGGGAATCTCGAGATTCCCAGGTTACACAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-935s1c1
Sequence:CCGGCTGCCCAGTGAATTGCTTCAACTCGAGTTGAAGCAATTCACTGGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-1123s1c1
Sequence:CCGGCCTGCCTATCTTCAAGAGAGACTCGAGTCTCTCTTGAAGATAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-724s1c1
Sequence:CCGGGAGGAACGTGATGGAAGTGTTCTCGAGAACACTTCCATCACGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-823s1c1
Sequence:CCGGGCACCATGAATCCATTCTCAACTCGAGTTGAGAATGGATTCATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-183s1c1
Sequence:CCGGCCCTAGAGATAATCTGCAGTACTCGAGTACTGCAGATTATCTCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145865
ANKS4B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 4B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-628s1c1
Sequence:CCGGGTCACTATCTAAGGGCATTAACTCGAGTTAATGCCCTTAGATAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-849s1c1
Sequence:CCGGCAGGTCTAGGAAGTATTGTTTCTCGAGAAACAATACTTCCTAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-370s1c1
Sequence:CCGGGCAGAATGAATGTGTTGCTCTCTCGAGAGAGCAACACATTCATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-309s1c1
Sequence:CCGGCCAACATCTTTGCCCTGGATACTCGAGTATCCAGGGCAAAGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-283s1c1
Sequence:CCGGCGTCTCATTCCTGGTCAACTTCTCGAGAAGTTGACCAGGAATGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145865.1-2012s1c1
Sequence:CCGGCGATCTGTGTAACCTGGGAATCTCGAGATTCCCAGGTTACACAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-935s1c1
Sequence:CCGGCTGCCCAGTGAATTGCTTCAACTCGAGTTGAAGCAATTCACTGGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-1123s1c1
Sequence:CCGGCCTGCCTATCTTCAAGAGAGACTCGAGTCTCTCTTGAAGATAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145865.1-724s1c1
Sequence:CCGGGAGGAACGTGATGGAAGTGTTCTCGAGAACACTTCCATCACGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-823s1c1
Sequence:CCGGGCACCATGAATCCATTCTCAACTCGAGTTGAGAATGGATTCATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145865.1-183s1c1
Sequence:CCGGCCCTAGAGATAATCTGCAGTACTCGAGTACTGCAGATTATCTCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)