EMAIL THIS PAGE TO A FRIEND

ANKS6

ankyrin repeat and sterile alpha motif domain containing 6

121 Gene Product Result for
Synonyms: ANKRD14 NPHP16 PKDR1 SAMD6
Gene ID:
Mouse(75691) ankyrin repeat and sterile alpha motif domain containing 6
Rat(362515) ankyrin repeat and sterile alpha motif domain containing 6
naked mole-rat(101719343) ankyrin repeat and sterile alpha motif domain containing 6
domestic guinea pig(100714121) ankyrin repeat and sterile alpha motif domain containing 6
sheep(101103301) ankyrin repeat and sterile alpha motif domain containing 6
Zebrafish(449657) ankyrin repeat and sterile alpha motif domain containing 6
dog(612138) ankyrin repeat and sterile alpha motif domain containing 6
Horse(100063895) ankyrin repeat and sterile alpha motif domain containing 6
cow(530846) ankyrin repeat and sterile alpha motif domain containing 6
domestic cat(101093308) ankyrin repeat and sterile alpha motif domain containing 6
chicken(420977) ankyrin repeat and sterile alpha motif domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173551 Rosetta Predictions human pricing
NM_001015028 Rosetta Predictions rat pricing
NM_001024136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169033 predicted 2340
2 SASI_Hs01_00169034 predicted 2487
3 SASI_Hs01_00169035 predicted 1229
4 SASI_Hs01_00169036 predicted 925
5 SASI_Hs01_00169037 predicted 937
6 SASI_Hs01_00169038 predicted 2002
7 SASI_Hs01_00169039 predicted 1670
8 SASI_Hs01_00169041 predicted 1890
9 SASI_Hs01_00169042 predicted 1581
10 SASI_Hs02_00368361 predicted 1168
11 SASI_Hs01_00169040 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112701 predicted 2672
2 SASI_Rn01_00112702 predicted 1770
3 SASI_Rn01_00112703 predicted 2290
4 SASI_Rn02_00202133 predicted 2694
5 SASI_Rn01_00112704 predicted 1330
6 SASI_Rn01_00112705 predicted 1225
7 SASI_Rn01_00112706 predicted 2543
8 SASI_Rn01_00112707 predicted 2498
9 SASI_Rn02_00202134 predicted 1226
10 SASI_Rn01_00112708 predicted 1022
11 SASI_Rn01_00112709 predicted 2273
12 SASI_Rn01_00112710 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112434 predicted 2135
2 SASI_Mm01_00112435 predicted 1204
3 SASI_Mm01_00112436 predicted 2331
4 SASI_Mm01_00112437 predicted 1683
5 SASI_Mm01_00112439 predicted 1108
6 SASI_Mm01_00112440 predicted 1038
7 SASI_Mm01_00112441 predicted 555
8 SASI_Mm01_00112442 predicted 2150
9 SASI_Mm01_00112443 predicted 1813
10 SASI_Mm02_00287560 predicted 798
11 SASI_Mm01_00112438 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173551
VALIDATED
ANKS6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 6
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-893s1c1
Sequence:CCGGGCGATTTCTGAACTGAACGCACTCGAGTGCGTTCAGTTCAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-740s1c1
Sequence:CCGGCTGACTGGAATCCTTAAGAAACTCGAGTTTCTTAAGGATTCCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-765s1c1
Sequence:CCGGCACTTGAGAAATATCAGCCCACTCGAGTGGGCTGATATTTCTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-855s1c1
Sequence:CCGGGAATTAAGACAGATGGGTCCACTCGAGTGGACCCATCTGTCTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-794s1c1
Sequence:CCGGGAACAAGAGGTGGACATGGAACTCGAGTTCCATGTCCACCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-962s1c1
Sequence:CCGGCACTCTTCCTTTGAGAGCAGTCTCGAGACTGCTCTCAAAGGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-573s1c1
Sequence:CCGGCTCCATCTGGAACTTCCACTACTCGAGTAGTGGAAGTTCCAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-55s1c1
Sequence:CCGGGAGTGACAAGCTGAAAGCAGTCTCGAGACTGCTTTCAGCTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-547s1c1
Sequence:CCGGGCAGAAATTGGAGACCAGCAACTCGAGTTGCTGGTCTCCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-848s1c1
Sequence:CCGGGAGCTGGGAATTAAGACAGATCTCGAGATCTGTCTTAATTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-734s1c1
Sequence:CCGGGATGAACTGACTGGAATCCTTCTCGAGAAGGATTCCAGTCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-948s1c1
Sequence:CCGGCCATTCACAACTTTCACTCTTCTCGAGAAGAGTGAAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-283s1c1
Sequence:CCGGCAATTCTGGAAACTTCAACCACTCGAGTGGTTGAAGTTTCCAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2770s21c1
Sequence:CCGGTCACGTCGACGGCATTCATTGCTCGAGCAATGAATGCCGTCGACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2794s21c1
Sequence:CCGGGTACTTCTTGCTGCAACAAACCTCGAGGTTTGTTGCAGCAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-3048s21c1
Sequence:CCGGCTCTTGGCCACTGGTAGTCATCTCGAGATGACTACCAGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173551
VALIDATED
ANKS6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 6
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-893s1c1
Sequence:CCGGGCGATTTCTGAACTGAACGCACTCGAGTGCGTTCAGTTCAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-740s1c1
Sequence:CCGGCTGACTGGAATCCTTAAGAAACTCGAGTTTCTTAAGGATTCCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-765s1c1
Sequence:CCGGCACTTGAGAAATATCAGCCCACTCGAGTGGGCTGATATTTCTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-855s1c1
Sequence:CCGGGAATTAAGACAGATGGGTCCACTCGAGTGGACCCATCTGTCTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-794s1c1
Sequence:CCGGGAACAAGAGGTGGACATGGAACTCGAGTTCCATGTCCACCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-962s1c1
Sequence:CCGGCACTCTTCCTTTGAGAGCAGTCTCGAGACTGCTCTCAAAGGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-573s1c1
Sequence:CCGGCTCCATCTGGAACTTCCACTACTCGAGTAGTGGAAGTTCCAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-55s1c1
Sequence:CCGGGAGTGACAAGCTGAAAGCAGTCTCGAGACTGCTTTCAGCTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-547s1c1
Sequence:CCGGGCAGAAATTGGAGACCAGCAACTCGAGTTGCTGGTCTCCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-848s1c1
Sequence:CCGGGAGCTGGGAATTAAGACAGATCTCGAGATCTGTCTTAATTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-734s1c1
Sequence:CCGGGATGAACTGACTGGAATCCTTCTCGAGAAGGATTCCAGTCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-948s1c1
Sequence:CCGGCCATTCACAACTTTCACTCTTCTCGAGAAGAGTGAAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-283s1c1
Sequence:CCGGCAATTCTGGAAACTTCAACCACTCGAGTGGTTGAAGTTTCCAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2770s21c1
Sequence:CCGGTCACGTCGACGGCATTCATTGCTCGAGCAATGAATGCCGTCGACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2794s21c1
Sequence:CCGGGTACTTCTTGCTGCAACAAACCTCGAGGTTTGTTGCAGCAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-3048s21c1
Sequence:CCGGCTCTTGGCCACTGGTAGTCATCTCGAGATGACTACCAGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173551
VALIDATED
ANKS6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 6
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-893s1c1
Sequence:CCGGGCGATTTCTGAACTGAACGCACTCGAGTGCGTTCAGTTCAGAAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-740s1c1
Sequence:CCGGCTGACTGGAATCCTTAAGAAACTCGAGTTTCTTAAGGATTCCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-765s1c1
Sequence:CCGGCACTTGAGAAATATCAGCCCACTCGAGTGGGCTGATATTTCTCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-855s1c1
Sequence:CCGGGAATTAAGACAGATGGGTCCACTCGAGTGGACCCATCTGTCTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-794s1c1
Sequence:CCGGGAACAAGAGGTGGACATGGAACTCGAGTTCCATGTCCACCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-962s1c1
Sequence:CCGGCACTCTTCCTTTGAGAGCAGTCTCGAGACTGCTCTCAAAGGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-573s1c1
Sequence:CCGGCTCCATCTGGAACTTCCACTACTCGAGTAGTGGAAGTTCCAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-55s1c1
Sequence:CCGGGAGTGACAAGCTGAAAGCAGTCTCGAGACTGCTTTCAGCTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-547s1c1
Sequence:CCGGGCAGAAATTGGAGACCAGCAACTCGAGTTGCTGGTCTCCAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-848s1c1
Sequence:CCGGGAGCTGGGAATTAAGACAGATCTCGAGATCTGTCTTAATTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173551.1-734s1c1
Sequence:CCGGGATGAACTGACTGGAATCCTTCTCGAGAAGGATTCCAGTCAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173551.1-948s1c1
Sequence:CCGGCCATTCACAACTTTCACTCTTCTCGAGAAGAGTGAAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_173551.1-283s1c1
Sequence:CCGGCAATTCTGGAAACTTCAACCACTCGAGTGGTTGAAGTTTCCAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2770s21c1
Sequence:CCGGTCACGTCGACGGCATTCATTGCTCGAGCAATGAATGCCGTCGACGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-2794s21c1
Sequence:CCGGGTACTTCTTGCTGCAACAAACCTCGAGGTTTGTTGCAGCAAGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173551.3-3048s21c1
Sequence:CCGGCTCTTGGCCACTGGTAGTCATCTCGAGATGACTACCAGTGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024136
ANKS6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and sterile alpha motif domain containing 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024136.1-3324s1c1
Sequence:CCGGCCAGTCATGTCCATCAGGATACTCGAGTATCCTGATGGACATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-2356s1c1
Sequence:CCGGCCATTCACAACTTCCACTCTTCTCGAGAAGAGTGGAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-806s1c1
Sequence:CCGGGTACAGGGATCTTGCTGAATACTCGAGTATTCAGCAAGATCCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3067s21c1
Sequence:CCGGTTGTAGTCTAGCTGCACATAACTCGAGTTATGTGCAGCTAGACTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3188s21c1
Sequence:CCGGCCCATAGGCTTCCTTCTTAAGCTCGAGCTTAAGAAGGAAGCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2844s21c1
Sequence:CCGGTGTGGCTGCCGTGGTTCATTTCTCGAGAAATGAACCACGGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2715s21c1
Sequence:CCGGCCGCATGGCTGCAGATGTAAACTCGAGTTTACATCTGCAGCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2903s21c1
Sequence:CCGGAGCTCGATGTTCTCCCTAATGCTCGAGCATTAGGGAGAACATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024136
ANKS6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and sterile alpha motif domain containing 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024136.1-3324s1c1
Sequence:CCGGCCAGTCATGTCCATCAGGATACTCGAGTATCCTGATGGACATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-2356s1c1
Sequence:CCGGCCATTCACAACTTCCACTCTTCTCGAGAAGAGTGGAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-806s1c1
Sequence:CCGGGTACAGGGATCTTGCTGAATACTCGAGTATTCAGCAAGATCCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3067s21c1
Sequence:CCGGTTGTAGTCTAGCTGCACATAACTCGAGTTATGTGCAGCTAGACTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3188s21c1
Sequence:CCGGCCCATAGGCTTCCTTCTTAAGCTCGAGCTTAAGAAGGAAGCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2844s21c1
Sequence:CCGGTGTGGCTGCCGTGGTTCATTTCTCGAGAAATGAACCACGGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2715s21c1
Sequence:CCGGCCGCATGGCTGCAGATGTAAACTCGAGTTTACATCTGCAGCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2903s21c1
Sequence:CCGGAGCTCGATGTTCTCCCTAATGCTCGAGCATTAGGGAGAACATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024136
ANKS6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and sterile alpha motif domain containing 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024136.1-3324s1c1
Sequence:CCGGCCAGTCATGTCCATCAGGATACTCGAGTATCCTGATGGACATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-2356s1c1
Sequence:CCGGCCATTCACAACTTCCACTCTTCTCGAGAAGAGTGGAAGTTGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024136.1-806s1c1
Sequence:CCGGGTACAGGGATCTTGCTGAATACTCGAGTATTCAGCAAGATCCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3067s21c1
Sequence:CCGGTTGTAGTCTAGCTGCACATAACTCGAGTTATGTGCAGCTAGACTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-3188s21c1
Sequence:CCGGCCCATAGGCTTCCTTCTTAAGCTCGAGCTTAAGAAGGAAGCCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2844s21c1
Sequence:CCGGTGTGGCTGCCGTGGTTCATTTCTCGAGAAATGAACCACGGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2715s21c1
Sequence:CCGGCCGCATGGCTGCAGATGTAAACTCGAGTTTACATCTGCAGCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024136.1-2903s21c1
Sequence:CCGGAGCTCGATGTTCTCCCTAATGCTCGAGCATTAGGGAGAACATCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks