EMAIL THIS PAGE TO A FRIEND

ANKUB1

ankyrin repeat and ubiquitin domain containing 1

37 Gene Product Result for
Synonyms: C3orf16
UniProtKB ID: A6NFN9
Gene ID:
Rat(100361272) ankyrin repeat and ubiquitin domain containing 1
cow(785299) ankyrin repeat and ubiquitin domain containing 1
Horse(100058185) ankyrin repeat and ubiquitin domain containing 1
domestic cat(101098979) ankyrin repeat and ubiquitin domain containing 1
dog(100683272) ankyrin repeat and ubiquitin domain containing 1
sheep(101102780) ankyrin repeat and ubiquitin domain containing 1
domestic guinea pig(100717401) ankyrin repeat and ubiquitin domain containing 1
naked mole-rat(101723852) ankyrin repeat and ubiquitin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144960 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226681 MISSION® esiRNA esiRNA targeting human C3orf16 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131739 Rosetta Predictions human pricing
XM_001132074 Rosetta Predictions human pricing
XM_001717444 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388620 predicted 586
2 SASI_Hs02_00388621 predicted 642
3 SASI_Hs02_00388622 predicted 832
4 SASI_Hs02_00388623 predicted 544
5 SASI_Hs02_00388624 predicted 841
6 SASI_Hs02_00388625 predicted 1098
7 SASI_Hs02_00388626 predicted 1231
8 SASI_Hs02_00388627 predicted 620
9 SASI_Hs02_00388628 predicted 460
10 SASI_Hs02_00388629 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389004 predicted 588
2 SASI_Hs02_00389005 predicted 646
3 SASI_Hs02_00389006 predicted 834
4 SASI_Hs02_00389007 predicted 546
5 SASI_Hs02_00389008 predicted 842
6 SASI_Hs02_00389009 predicted 1098
7 SASI_Hs02_00389010 predicted 1235
8 SASI_Hs02_00389011 predicted 618
9 SASI_Hs02_00389012 predicted 468
10 SASI_Hs02_00389013 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417254 predicted 584
2 SASI_Hs02_00417255 predicted 646
3 SASI_Hs02_00417256 predicted 840
4 SASI_Hs02_00417257 predicted 543
5 SASI_Hs02_00417258 predicted 840
6 SASI_Hs02_00417259 predicted 1094
7 SASI_Hs02_00417260 predicted 1233
8 SASI_Hs02_00417261 predicted 617
9 SASI_Hs02_00417262 predicted 464
10 SASI_Hs02_00417263 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144960
ANKUB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and ubiquitin domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-888s21c1
Sequence:CCGGAGGACTACCAGACTGATATTGCTCGAGCAATATCAGTCTGGTAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-535s21c1
Sequence:CCGGGCTGATGATAAAGGATTATTTCTCGAGAAATAATCCTTTATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-1816s21c1
Sequence:CCGGAGTTTCAAGAGTGGGATATTCCTCGAGGAATATCCCACTCTTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-694s21c1
Sequence:CCGGAGAAGACAAGCCTACTCTATACTCGAGTATAGAGTAGGCTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144960.1-2114s21c1
Sequence:CCGGTGGACAAAGACCTGATCAAACCTCGAGGTTTGATCAGGTCTTTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144960
ANKUB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and ubiquitin domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-888s21c1
Sequence:CCGGAGGACTACCAGACTGATATTGCTCGAGCAATATCAGTCTGGTAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-535s21c1
Sequence:CCGGGCTGATGATAAAGGATTATTTCTCGAGAAATAATCCTTTATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-1816s21c1
Sequence:CCGGAGTTTCAAGAGTGGGATATTCCTCGAGGAATATCCCACTCTTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-694s21c1
Sequence:CCGGAGAAGACAAGCCTACTCTATACTCGAGTATAGAGTAGGCTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144960.1-2114s21c1
Sequence:CCGGTGGACAAAGACCTGATCAAACCTCGAGGTTTGATCAGGTCTTTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144960
ANKUB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and ubiquitin domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-888s21c1
Sequence:CCGGAGGACTACCAGACTGATATTGCTCGAGCAATATCAGTCTGGTAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-535s21c1
Sequence:CCGGGCTGATGATAAAGGATTATTTCTCGAGAAATAATCCTTTATCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-1816s21c1
Sequence:CCGGAGTTTCAAGAGTGGGATATTCCTCGAGGAATATCCCACTCTTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144960.1-694s21c1
Sequence:CCGGAGAAGACAAGCCTACTCTATACTCGAGTATAGAGTAGGCTTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144960.1-2114s21c1
Sequence:CCGGTGGACAAAGACCTGATCAAACCTCGAGGTTTGATCAGGTCTTTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)