EMAIL THIS PAGE TO A FRIEND

ANKZF1

ankyrin repeat and zinc finger domain containing 1

116 Gene Product Result for
Synonyms: ZNF744
UniProtKB ID: Q9H8Y5, Q9NVZ4
Gene ID:
Mouse(52231) ankyrin repeat and zinc finger domain containing 1
Rat(363255) ankyrin repeat and zinc finger domain containing 1
naked mole-rat(101720967) ankyrin repeat and zinc finger domain containing 1
domestic guinea pig(100735614) ankyrin repeat and zinc finger domain containing 1
sheep(101116023) ankyrin repeat and zinc finger domain containing 1
Zebrafish(553307) ankyrin repeat and zinc finger domain containing 1
cow(507867) ankyrin repeat and zinc finger domain containing 1
Horse(100056175) ankyrin repeat and zinc finger domain containing 1
domestic cat(101095037) ankyrin repeat and zinc finger domain containing 1
dog(478916) ankyrin repeat and zinc finger domain containing 1
chicken(429038) ankyrin repeat and zinc finger domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108505 Anti-ANKZF1 affinity isolated antibody human, rabbit, guinea pig, human, canine, horse, bovine, rat
western blot pricing
SAB1407618 Anti-ANKZF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV35950 Anti-ANKZF1 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, rabbit, canine, horse, bovine
immunohistochemistry, western blot pricing
HPA035208 Anti-ANKZF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104258 Anti-ANKZF1, (N-terminal) antibody produced in rabbit affinity isolated antibody zebrafish, mouse, guinea pig, horse, canine, rabbit, human, rat, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018089 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042410 Rosetta Predictions human pricing
NM_018089 Rosetta Predictions human pricing
NM_001014219 Rosetta Predictions rat pricing
NM_026187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309588 predicted 2208
2 SASI_Hs02_00309589 predicted 1869
3 SASI_Hs02_00309590 predicted 1804
4 SASI_Hs02_00309591 predicted 745
5 SASI_Hs02_00309592 predicted 770
6 SASI_Hs02_00309593 predicted 903
7 SASI_Hs02_00309594 predicted 1213
8 SASI_Hs02_00309595 predicted 351
9 SASI_Hs02_00309596 predicted 1127
10 SASI_Hs02_00309597 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351263 predicted 2285
2 SASI_Hs02_00351264 predicted 1935
3 SASI_Hs02_00351265 predicted 1884
4 SASI_Hs01_00133941 predicted 815
5 SASI_Hs02_00351266 predicted 837
6 SASI_Hs01_00133942 predicted 975
7 SASI_Hs01_00133947 predicted 1282
8 SASI_Hs01_00133948 predicted 426
9 SASI_Hs01_00133949 predicted 1195
10 SASI_Hs02_00351267 predicted 369
11 SASI_Hs01_00133940 predicted 780
12 SASI_Hs01_00133943 predicted 359
13 SASI_Hs01_00133944 predicted 311
14 SASI_Hs01_00133945 predicted 763
15 SASI_Hs01_00133946 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096149 predicted 1843
2 SASI_Rn01_00096150 predicted 1468
3 SASI_Rn01_00096151 predicted 2023
4 SASI_Rn01_00096152 predicted 551
5 SASI_Rn01_00096153 predicted 614
6 SASI_Rn01_00096154 predicted 543
7 SASI_Rn01_00096155 predicted 1324
8 SASI_Rn01_00096156 predicted 2052
9 SASI_Rn02_00201753 predicted 608
10 SASI_Rn01_00096158 predicted 472
11 SASI_Rn01_00096157 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329844 predicted 1136
2 SASI_Mm02_00329845 predicted 1942
3 SASI_Mm02_00329846 predicted 578
4 SASI_Mm02_00329847 predicted 1944
5 SASI_Mm02_00329848 predicted 1563
6 SASI_Mm02_00329849 predicted 572
7 SASI_Mm02_00329850 predicted 644
8 SASI_Mm02_00329851 predicted 1581
9 SASI_Mm02_00329852 predicted 904
10 SASI_Mm02_00329853 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026187
VALIDATED
ANKZF1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and zinc finger domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1626s21c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-2109s21c1
Sequence:CCGGGCTGACAAATCAACGCGTAATCTCGAGATTACGCGTTGATTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026187.4-2629s21c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1570s21c1
Sequence:CCGGAGGATGAAGAACCACTCAAACCTCGAGGTTTGAGTGGTTCTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-665s21c1
Sequence:CCGGGCTTGATTGGCATCGCTTTAACTCGAGTTAAAGCGATGCCAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-422s1c1
Sequence:CCGGCAGGAAGAAGATGGTTCCGAACTCGAGTTCGGAACCATCTTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-1446s1c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-631s1c1
Sequence:CCGGCCCATTGGATACTTTGGTCTACTCGAGTAGACCAAAGTATCCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-443s1c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-924s1c1
Sequence:CCGGCAGCTGACAAATCAACGCGTACTCGAGTACGCGTTGATTTGTCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026187
VALIDATED
ANKZF1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and zinc finger domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1626s21c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-2109s21c1
Sequence:CCGGGCTGACAAATCAACGCGTAATCTCGAGATTACGCGTTGATTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026187.4-2629s21c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1570s21c1
Sequence:CCGGAGGATGAAGAACCACTCAAACCTCGAGGTTTGAGTGGTTCTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-665s21c1
Sequence:CCGGGCTTGATTGGCATCGCTTTAACTCGAGTTAAAGCGATGCCAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-422s1c1
Sequence:CCGGCAGGAAGAAGATGGTTCCGAACTCGAGTTCGGAACCATCTTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-1446s1c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-631s1c1
Sequence:CCGGCCCATTGGATACTTTGGTCTACTCGAGTAGACCAAAGTATCCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-443s1c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-924s1c1
Sequence:CCGGCAGCTGACAAATCAACGCGTACTCGAGTACGCGTTGATTTGTCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026187
VALIDATED
ANKZF1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and zinc finger domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1626s21c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-2109s21c1
Sequence:CCGGGCTGACAAATCAACGCGTAATCTCGAGATTACGCGTTGATTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026187.4-2629s21c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-1570s21c1
Sequence:CCGGAGGATGAAGAACCACTCAAACCTCGAGGTTTGAGTGGTTCTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026187.4-665s21c1
Sequence:CCGGGCTTGATTGGCATCGCTTTAACTCGAGTTAAAGCGATGCCAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-422s1c1
Sequence:CCGGCAGGAAGAAGATGGTTCCGAACTCGAGTTCGGAACCATCTTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-1446s1c1
Sequence:CCGGCCTCCTCATGAAGCTTGACATCTCGAGATGTCAAGCTTCATGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-631s1c1
Sequence:CCGGCCCATTGGATACTTTGGTCTACTCGAGTAGACCAAAGTATCCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026187.3-443s1c1
Sequence:CCGGGTAGAGTTGGAGCTAGTAGAACTCGAGTTCTACTAGCTCCAACTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026187.3-924s1c1
Sequence:CCGGCAGCTGACAAATCAACGCGTACTCGAGTACGCGTTGATTTGTCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018089
VALIDATED
ANKZF1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and zinc finger domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018089.1-764s1c1
Sequence:CCGGCTGGTGCTATATTTCAAGGAACTCGAGTTCCTTGAAATATAGCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-756s1c1
Sequence:CCGGGCACTTTGCTGGTGCTATATTCTCGAGAATATAGCACCAGCAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-363s1c1
Sequence:CCGGCCAAGAACAGAGGGAACATTACTCGAGTAATGTTCCCTCTGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-552s1c1
Sequence:CCGGGAGGGCTACATTTGAGAAGTTCTCGAGAACTTCTCAAATGTAGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-397s1c1
Sequence:CCGGCATCGGTTTAACCTAAAGCAACTCGAGTTGCTTTAGGTTAAACCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018089.1-1863s1c1
Sequence:CCGGCGAAGGTTCATGGAGAAGAATCTCGAGATTCTTCTCCATGAACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-905s1c1
Sequence:CCGGGCTACAATGAAGCCACACTATCTCGAGATAGTGTGGCTTCATTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1020s1c1
Sequence:CCGGGTCTTTGTTCTTTGGAGGCAACTCGAGTTGCCTCCAAAGAACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1836s1c1
Sequence:CCGGGCTGACAAATCAACACGTAATCTCGAGATTACGTGTTGATTTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018089
VALIDATED
ANKZF1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and zinc finger domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018089.1-764s1c1
Sequence:CCGGCTGGTGCTATATTTCAAGGAACTCGAGTTCCTTGAAATATAGCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-756s1c1
Sequence:CCGGGCACTTTGCTGGTGCTATATTCTCGAGAATATAGCACCAGCAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-363s1c1
Sequence:CCGGCCAAGAACAGAGGGAACATTACTCGAGTAATGTTCCCTCTGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-552s1c1
Sequence:CCGGGAGGGCTACATTTGAGAAGTTCTCGAGAACTTCTCAAATGTAGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-397s1c1
Sequence:CCGGCATCGGTTTAACCTAAAGCAACTCGAGTTGCTTTAGGTTAAACCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018089.1-1863s1c1
Sequence:CCGGCGAAGGTTCATGGAGAAGAATCTCGAGATTCTTCTCCATGAACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-905s1c1
Sequence:CCGGGCTACAATGAAGCCACACTATCTCGAGATAGTGTGGCTTCATTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1020s1c1
Sequence:CCGGGTCTTTGTTCTTTGGAGGCAACTCGAGTTGCCTCCAAAGAACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1836s1c1
Sequence:CCGGGCTGACAAATCAACACGTAATCTCGAGATTACGTGTTGATTTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018089
VALIDATED
ANKZF1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and zinc finger domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018089.1-764s1c1
Sequence:CCGGCTGGTGCTATATTTCAAGGAACTCGAGTTCCTTGAAATATAGCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-756s1c1
Sequence:CCGGGCACTTTGCTGGTGCTATATTCTCGAGAATATAGCACCAGCAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-363s1c1
Sequence:CCGGCCAAGAACAGAGGGAACATTACTCGAGTAATGTTCCCTCTGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-552s1c1
Sequence:CCGGGAGGGCTACATTTGAGAAGTTCTCGAGAACTTCTCAAATGTAGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-397s1c1
Sequence:CCGGCATCGGTTTAACCTAAAGCAACTCGAGTTGCTTTAGGTTAAACCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018089.1-1863s1c1
Sequence:CCGGCGAAGGTTCATGGAGAAGAATCTCGAGATTCTTCTCCATGAACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018089.1-905s1c1
Sequence:CCGGGCTACAATGAAGCCACACTATCTCGAGATAGTGTGGCTTCATTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1020s1c1
Sequence:CCGGGTCTTTGTTCTTTGGAGGCAACTCGAGTTGCCTCCAAAGAACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018089.1-1836s1c1
Sequence:CCGGGCTGACAAATCAACACGTAATCTCGAGATTACGTGTTGATTTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)