EMAIL THIS PAGE TO A FRIEND

ANLN

anillin, actin binding protein

123 Gene Product Result for
Synonyms: Scraps scra
UniProtKB ID: Q9NQW6, Q5CZ78, Q6NSK5, Q9H8Y4, Q9NVN9, Q9NVP0
Gene ID:
Mouse(68743) anillin, actin binding protein
Rat(363031) anillin, actin binding protein
Zebrafish(562517) anillin, actin binding protein
chicken(420738) anillin, actin binding protein
cow(518274) anillin, actin binding protein
domestic cat(101100550) anillin, actin binding protein
dog(482401) anillin, actin binding protein
sheep(101116045) anillin, actin binding protein
Domestic Rabbit(100351074) anillin, actin binding protein
domestic guinea pig(100715412) anillin, actin binding protein
naked mole-rat(101719442) anillin, actin binding protein
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500069 Anti-ANILLIN /SCRAPS, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunohistochemistry pricing
SAB2500070 Anti-ANILLIN/SCRAPS (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, human, mouse
ELISA, western blot pricing
SAB1407544 Anti-ANLN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA050556 Anti-ANLN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA005680 Anti-ANLN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90662 Monoclonal Anti-ANLN antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0303, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB90660 Monoclonal Anti-ANLN antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0301, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018685 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018685 Rosetta Predictions human pricing
XM_001077789 Rosetta Predictions rat pricing
XM_343362 Rosetta Predictions rat pricing
NM_028390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352198 predicted 1436
2 SASI_Hs01_00017294 predicted 2172
3 SASI_Hs01_00017295 predicted 803
4 SASI_Hs01_00017296 predicted 2041
5 SASI_Hs01_00017297 predicted 1517
6 SASI_Hs01_00017298 predicted 1192
7 SASI_Hs01_00017299 predicted 1180
8 SASI_Hs01_00017300 predicted 665
9 SASI_Hs01_00017301 predicted 1090
10 SASI_Hs01_00017303 predicted 1100
11 SASI_Hs01_00017302 predicted 2751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358552 predicted 1651
2 SASI_Rn02_00358553 predicted 1251
3 SASI_Rn02_00358554 predicted 1989
4 SASI_Rn02_00358555 predicted 1460
5 SASI_Rn02_00358556 predicted 2002
6 SASI_Rn02_00358557 predicted 518
7 SASI_Rn02_00358558 predicted 1982
8 SASI_Rn02_00358559 predicted 2024
9 SASI_Rn02_00358560 predicted 1544
10 SASI_Rn02_00358561 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182867 predicted 2856
2 SASI_Rn01_00182868 predicted 2121
3 SASI_Rn01_00182869 predicted 3024
4 SASI_Rn01_00182870 predicted 2908
5 SASI_Rn01_00182871 predicted 2521
6 SASI_Rn01_00182872 predicted 2627
7 SASI_Rn01_00182873 predicted 2877
8 SASI_Rn01_00182874 predicted 1890
9 SASI_Rn01_00182875 predicted 1669
10 SASI_Rn01_00182876 predicted 2531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027283 predicted 2586
2 SASI_Mm01_00027284 predicted 3258
3 SASI_Mm01_00027285 predicted 799
4 SASI_Mm01_00027286 predicted 3063
5 SASI_Mm01_00027287 predicted 3008
6 SASI_Mm01_00027289 predicted 3226
7 SASI_Mm01_00027291 predicted 206
8 SASI_Mm02_00333788 predicted 3120
9 SASI_Mm01_00027292 predicted 3537
10 SASI_Mm02_00333789 predicted 2823
11 SASI_Mm01_00027288 predicted 776
12 SASI_Mm01_00027290 predicted 2826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028390
VALIDATED
ANLN MISSION shRNA Bacterial Glycerol Stock
anillin, actin binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3679s1c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2981s1c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-926s1c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2084s1c1
Sequence:CCGGGCCTAGAGAATGTAATTTCTTCTCGAGAAGAAATTACATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3385s1c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028390.2-3643s21c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-2945s21c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-3349s21c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-890s21c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028390
VALIDATED
ANLN MISSION shRNA shRNA Plasmid DNA
anillin, actin binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3679s1c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2981s1c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-926s1c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2084s1c1
Sequence:CCGGGCCTAGAGAATGTAATTTCTTCTCGAGAAGAAATTACATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3385s1c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028390.2-3643s21c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-2945s21c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-3349s21c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-890s21c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028390
VALIDATED
ANLN MISSION shRNA Lentiviral Transduction Particles
anillin, actin binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3679s1c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2981s1c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-926s1c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-2084s1c1
Sequence:CCGGGCCTAGAGAATGTAATTTCTTCTCGAGAAGAAATTACATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028390.1-3385s1c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028390.2-3643s21c1
Sequence:CCGGGCAGGTTGTATTCTATGCTTTCTCGAGAAAGCATAGAATACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-2945s21c1
Sequence:CCGGGCAGCCTTCATTCTTCAGTTACTCGAGTAACTGAAGAATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-3349s21c1
Sequence:CCGGCGCAACACTCTGGAATTGATTCTCGAGAATCAATTCCAGAGTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028390.2-890s21c1
Sequence:CCGGCCGCTTGTTTATCCAAATCTTCTCGAGAAGATTTGGATAAACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018685
VALIDATED
ANLN MISSION shRNA Bacterial Glycerol Stock
anillin, actin binding protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2934s1c1
Sequence:CCGGCCTCACATCTATAACCACAAACTCGAGTTTGTGGTTATAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-3691s1c1
Sequence:CCGGGCCAATATTCACTACGTATTACTCGAGTAATACGTAGTGAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1004s1c1
Sequence:CCGGCCTCTTTGAATAAAGCCCTATCTCGAGATAGGGCTTTATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2263s1c1
Sequence:CCGGCCATCAATAAAGCAGGTGATTCTCGAGAATCACCTGCTTTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1003s1c1
Sequence:CCGGGCCTCTTTGAATAAAGCCCTACTCGAGTAGGGCTTTATTCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018685
VALIDATED
ANLN MISSION shRNA shRNA Plasmid DNA
anillin, actin binding protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2934s1c1
Sequence:CCGGCCTCACATCTATAACCACAAACTCGAGTTTGTGGTTATAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-3691s1c1
Sequence:CCGGGCCAATATTCACTACGTATTACTCGAGTAATACGTAGTGAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1004s1c1
Sequence:CCGGCCTCTTTGAATAAAGCCCTATCTCGAGATAGGGCTTTATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2263s1c1
Sequence:CCGGCCATCAATAAAGCAGGTGATTCTCGAGAATCACCTGCTTTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1003s1c1
Sequence:CCGGGCCTCTTTGAATAAAGCCCTACTCGAGTAGGGCTTTATTCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018685
VALIDATED
ANLN MISSION shRNA Lentiviral Transduction Particles
anillin, actin binding protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2934s1c1
Sequence:CCGGCCTCACATCTATAACCACAAACTCGAGTTTGTGGTTATAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-3691s1c1
Sequence:CCGGGCCAATATTCACTACGTATTACTCGAGTAATACGTAGTGAATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1004s1c1
Sequence:CCGGCCTCTTTGAATAAAGCCCTATCTCGAGATAGGGCTTTATTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018685.2-2263s1c1
Sequence:CCGGCCATCAATAAAGCAGGTGATTCTCGAGAATCACCTGCTTTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018685.2-1003s1c1
Sequence:CCGGGCCTCTTTGAATAAAGCCCTACTCGAGTAGGGCTTTATTCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks