EMAIL THIS PAGE TO A FRIEND

ANO10

anoctamin 10

57 Gene Product Result for
Synonyms: SCAR10 TMEM16K
Gene ID:
Human(55129) Summary: The transmembrane protein encoded by this gene is a member of a family of calcium-activated chloride channels. Defects in this gene may be a cause of autosomal recessive spinocerebellar ataxia-10. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
Mouse(102566) anoctamin 10
Rat(301111) anoctamin 10
chicken(420674) anoctamin 10
dog(477010) anoctamin 10
cow(534290) anoctamin 10
Horse(100054874) anoctamin 10
sheep(101118480) anoctamin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018075 Rosetta Predictions human pricing
XM_001078269 Rosetta Predictions rat pricing
XM_236774 Rosetta Predictions rat pricing
NM_133979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051004 predicted 781
2 SASI_Hs01_00051005 predicted 1635
3 SASI_Hs01_00051006 predicted 1585
4 SASI_Hs01_00051008 predicted 1868
5 SASI_Hs01_00051009 predicted 1350
6 SASI_Hs02_00351224 predicted 671
7 SASI_Hs01_00051011 predicted 843
8 SASI_Hs02_00351225 predicted 1787
9 SASI_Hs02_00351226 predicted 1520
10 SASI_Hs01_00051012 predicted 747
11 SASI_Hs01_00051007 predicted 1382
12 SASI_Hs01_00051010 predicted 2069
13 SASI_Hs01_00051013 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360197 predicted 1876
2 SASI_Rn02_00360198 predicted 1781
3 SASI_Rn02_00360199 predicted 1493
4 SASI_Rn02_00360200 predicted 862
5 SASI_Rn02_00360201 predicted 1355
6 SASI_Rn02_00360202 predicted 1222
7 SASI_Rn02_00360203 predicted 2035
8 SASI_Rn02_00360204 predicted 1122
9 SASI_Rn02_00360205 predicted 1862
10 SASI_Rn02_00360206 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390410 predicted 1882
2 SASI_Rn02_00390411 predicted 1789
3 SASI_Rn02_00390412 predicted 1488
4 SASI_Rn02_00390413 predicted 864
5 SASI_Rn02_00390414 predicted 1352
6 SASI_Rn02_00390415 predicted 1217
7 SASI_Rn02_00390416 predicted 2040
8 SASI_Rn02_00390417 predicted 1121
9 SASI_Rn02_00390418 predicted 1863
10 SASI_Rn02_00390419 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180237 predicted 813
2 SASI_Mm01_00180238 predicted 1403
3 SASI_Mm01_00180239 predicted 1786
4 SASI_Mm01_00180240 predicted 1434
5 SASI_Mm02_00339107 predicted 1770
6 SASI_Mm01_00180243 predicted 1612
7 SASI_Mm01_00180244 predicted 1950
8 SASI_Mm01_00180245 predicted 1544
9 SASI_Mm01_00180246 predicted 1954
10 SASI_Mm02_00339108 predicted 1014
11 SASI_Mm01_00180241 predicted 1245
12 SASI_Mm01_00180242 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018075
VALIDATED
ANO10 MISSION shRNA Bacterial Glycerol Stock
anoctamin 10
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1591s1c1
Sequence:CCGGCCCAATGCTTAGCCAAACGAACTCGAGTTCGTTTGGCTAAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018075.2-1587s1c1
Sequence:CCGGCAGACCCAATGCTTAGCCAAACTCGAGTTTGGCTAAGCATTGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-369s1c1
Sequence:CCGGCACATACAGAACCAGACAGAACTCGAGTTCTGTCTGGTTCTGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1231s1c1
Sequence:CCGGCCACAAGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1348s1c1
Sequence:CCGGCCACGGCATATCCAGATGAAACTCGAGTTTCATCTGGATATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-1434s1c1
Sequence:CCGGGAACCTGAAGGAGGAACCAATCTCGAGATTGGTTCCTCCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1095s21c1
Sequence:CCGGCAAGAGACAGTTGCGCATTTACTCGAGTAAATGCGCAACTGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-980s1c1
Sequence:CCGGCCTTTGATGATTACTTGGAGTCTCGAGACTCCAAGTAATCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-913s1c1
Sequence:CCGGGCAGACATTGATGCTACATTACTCGAGTAATGTAGCATCAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1037s21c1
Sequence:CCGGATGGTGTCTTGGGTATCAATTCTCGAGAATTGATACCCAAGACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1874s21c1
Sequence:CCGGTCACTAACTGTGCGCTGATTGCTCGAGCAATCAGCGCACAGTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-215s21c1
Sequence:CCGGTCACACCTTTGGTGGTCATAGCTCGAGCTATGACCACCAAAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1288s21c1
Sequence:CCGGATGAATCGTCTCTATCGATATCTCGAGATATCGATAGAGACGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018075
VALIDATED
ANO10 MISSION shRNA shRNA Plasmid DNA
anoctamin 10
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1591s1c1
Sequence:CCGGCCCAATGCTTAGCCAAACGAACTCGAGTTCGTTTGGCTAAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018075.2-1587s1c1
Sequence:CCGGCAGACCCAATGCTTAGCCAAACTCGAGTTTGGCTAAGCATTGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-369s1c1
Sequence:CCGGCACATACAGAACCAGACAGAACTCGAGTTCTGTCTGGTTCTGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1231s1c1
Sequence:CCGGCCACAAGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1348s1c1
Sequence:CCGGCCACGGCATATCCAGATGAAACTCGAGTTTCATCTGGATATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-1434s1c1
Sequence:CCGGGAACCTGAAGGAGGAACCAATCTCGAGATTGGTTCCTCCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1095s21c1
Sequence:CCGGCAAGAGACAGTTGCGCATTTACTCGAGTAAATGCGCAACTGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-980s1c1
Sequence:CCGGCCTTTGATGATTACTTGGAGTCTCGAGACTCCAAGTAATCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-913s1c1
Sequence:CCGGGCAGACATTGATGCTACATTACTCGAGTAATGTAGCATCAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1037s21c1
Sequence:CCGGATGGTGTCTTGGGTATCAATTCTCGAGAATTGATACCCAAGACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1874s21c1
Sequence:CCGGTCACTAACTGTGCGCTGATTGCTCGAGCAATCAGCGCACAGTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-215s21c1
Sequence:CCGGTCACACCTTTGGTGGTCATAGCTCGAGCTATGACCACCAAAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1288s21c1
Sequence:CCGGATGAATCGTCTCTATCGATATCTCGAGATATCGATAGAGACGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018075
VALIDATED
ANO10 MISSION shRNA Lentiviral Transduction Particles
anoctamin 10
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1591s1c1
Sequence:CCGGCCCAATGCTTAGCCAAACGAACTCGAGTTCGTTTGGCTAAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018075.2-1587s1c1
Sequence:CCGGCAGACCCAATGCTTAGCCAAACTCGAGTTTGGCTAAGCATTGGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-369s1c1
Sequence:CCGGCACATACAGAACCAGACAGAACTCGAGTTCTGTCTGGTTCTGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1231s1c1
Sequence:CCGGCCACAAGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_018075.2-1348s1c1
Sequence:CCGGCCACGGCATATCCAGATGAAACTCGAGTTTCATCTGGATATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-1434s1c1
Sequence:CCGGGAACCTGAAGGAGGAACCAATCTCGAGATTGGTTCCTCCTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1095s21c1
Sequence:CCGGCAAGAGACAGTTGCGCATTTACTCGAGTAAATGCGCAACTGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018075.2-980s1c1
Sequence:CCGGCCTTTGATGATTACTTGGAGTCTCGAGACTCCAAGTAATCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018075.2-913s1c1
Sequence:CCGGGCAGACATTGATGCTACATTACTCGAGTAATGTAGCATCAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1037s21c1
Sequence:CCGGATGGTGTCTTGGGTATCAATTCTCGAGAATTGATACCCAAGACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1874s21c1
Sequence:CCGGTCACTAACTGTGCGCTGATTGCTCGAGCAATCAGCGCACAGTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-215s21c1
Sequence:CCGGTCACACCTTTGGTGGTCATAGCTCGAGCTATGACCACCAAAGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018075.3-1288s21c1
Sequence:CCGGATGAATCGTCTCTATCGATATCTCGAGATATCGATAGAGACGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133979
ANO10 MISSION shRNA Bacterial Glycerol Stock
anoctamin 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-1914s1c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-785s1c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2434s1c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2232s1c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2433s21c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-784s21c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2231s21c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-1913s21c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133979
ANO10 MISSION shRNA shRNA Plasmid DNA
anoctamin 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-1914s1c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-785s1c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2434s1c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2232s1c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2433s21c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-784s21c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2231s21c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-1913s21c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133979
ANO10 MISSION shRNA Lentiviral Transduction Particles
anoctamin 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-1914s1c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133979.1-785s1c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2434s1c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133979.1-2232s1c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2433s21c1
Sequence:CCGGGCTTAGTGTCTGTGCCCATTACTCGAGTAATGGGCACAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-784s21c1
Sequence:CCGGCCTGTTTGTGTGGGAAGACTACTCGAGTAGTCTTCCCACACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133979.2-2231s21c1
Sequence:CCGGGCTCTCTCTCAGTACCTCTTTCTCGAGAAAGAGGTACTGAGAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133979.2-1913s21c1
Sequence:CCGGGCATTTGCCATCCCTGATAAACTCGAGTTTATCAGGGATGGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks